1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melomori [17]
2 years ago
15

The sharing of electrons is characteristic of ionic bonds. true or false??

Biology
1 answer:
goldfiish [28.3K]2 years ago
3 0
I’m not really sure but i think it’s true
You might be interested in
A star that collapses becomes what
Sati [7]

Answer: A star that collaspes is called a neutron star

Explanation: Have a great day! ;)

4 0
2 years ago
Which of the following does not occur due to passive transport?
DIA [1.3K]
A I think I hope this helped
6 0
3 years ago
Which substances protect against oxidative stress and the resultant tissue damage at the cellular level?
BaLLatris [955]
The substances that protect against oxidative stress and the resultant tissue damage at the cellular level is, option B. Antioxidants. Oxidation can cause imbalance in the body. Antioxidants are used to counteract the damage produced by free radicals. Good natural sources of antioxidants include fruits and vegetables.
7 0
2 years ago
Read 2 more answers
Which feature do both roundworms and segmented worms have?
MrMuchimi

Answer:

D

Explanation:

4 0
2 years ago
What is the function of prolactin and progestrone?
chubhunter [2.5K]

Explanation:

Prolactin is a protein hormone of the anterior pituitary gland that was originally named for its ability to promote lactation in response to the suckling stimulus of hungry young mammals.

Progesterone is a hormone released by the corpus luteum in the ovary. It plays important roles in the menstrual cycle and in maintaining the early stages of pregnancy.

8 0
3 years ago
Other questions:
  • Can you give me 5 chordates? preferably ones that live in oregon hhhh
    6·1 answer
  • Researchers studying a species of endangered bird were interested in whether a relationship exists between the number of eggs la
    13·1 answer
  • The four organic molecules are listed below. Which ones do you get from the foods you eat? Check all that apply. Carbohydrate Nu
    6·1 answer
  • The nerves that control voluntary responses like those connected to your muscles are part of the _____ nervous system.
    8·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The prediction of the evolutionary model expects an increase in variety of new organisms. true false
    13·2 answers
  • What is the answer to 4?
    12·1 answer
  • Which of the following would have the greatest ecosystem diversity? Group of answer choices a lake a prairie the land an organic
    13·2 answers
  • DNA _____.
    6·2 answers
  • Which artery travels in the coronary sulcus between the left atrium and the left ventricle of the heart
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!