1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
3 years ago
13

Helpppp , I’ll give you 25 points and a brainy .

Biology
1 answer:
neonofarm [45]3 years ago
8 0
A Respiration by animals CO2 is being added.
B trees burning same
C tree leaves removed
D oil added
You might be interested in
Microscopes require that specimens be non-living in order to be observed
blsea [12.9K]

Answer:

:<

Explanation:

:P

7 0
3 years ago
List five on usefulness of biology ​
Shalnov [3]
1.
the Changes of the Human Bodies
2. Shapes Different Careers
3. Provides Answers to Large-scale Problems
4. Teaches Concepts on Basic Living
5. Helps in Answering the Fundamental Questions About Life
6. Have another for (good luck) Paves Way for Scientific Investigations

6 0
2 years ago
The scarlet cup fungus (Sarcoscypha coccinea) obtains its nutrition from decaying wood by releasing digestive enzymes into the w
kolbaska11 [484]
II and III only. The fungus is a heterotroph, since it's not making it's own food, but it's also a Saprotroph (since it externally digests dead organic materials; saprotrophs are a special subset of heterotrophs).
6 0
4 years ago
How can low-calorie sweeteners keep teeth healthy?
tatiyna
Artificial sweeteners help reduce the amount of sugar in the diet with obvious benefits for general health. It can also make a big difference in your dental health by helping you prevent tooth decay.
5 0
3 years ago
Read 2 more answers
Name the process inanimals which require meiosis to take place
earnstyle [38]
In process of meiosis. The hypothalamus or the master gland in most animals, including humans send signals to the ovaries and testes of the reproductive system. In response to these signals, these ovaries and testes undergoes the sex cells division which is called meiosis. Spermatogenesis in male gametes, is the process of sex cell division among sperm cells. On the other hand, oogenesis is for the female gametes. These cell divisions among respective gametes produces haploid cell which only contain one pair of chromosomes, in number -23.

In response to this inquiry's question. Simply reproduction.



8 0
3 years ago
Read 2 more answers
Other questions:
  • Pls help me for this <br> urgent ​
    5·2 answers
  • An organism that uses energy to produce its own food supply from inorganic compounds is called a(an)
    8·1 answer
  • Answer the above please correct answer brainliest​
    5·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • An amobea moves by pushing out small projections called blank and then pulling the rest of the organisms along
    5·1 answer
  • Which of the following cell types is haploid?
    15·2 answers
  • I NEED HELP FOR ONLY QUESTION 10!!!!
    10·1 answer
  • The graph the speed of Sam,s car over time.
    14·1 answer
  • Using the phylogenetic tree which is more related fungi and animals or plants and fungi. Explain why​
    5·1 answer
  • Hi everyone
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!