1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
givi [52]
4 years ago
14

28. What specific adaptation has the sub-type of CAM plants derived to reduce the amount of water lost in dry environments?

Biology
1 answer:
zhannawk [14.2K]4 years ago
8 0

Answer: a. Stomata open at Night

Explanation:

As a tactic to minimize photorespiration in warm regions, many water-storing plants such as cacti and pineapples modified its method of carbon fixation. This process is called Crassulacean Acid Metabolism (CAM), following the plant family Crassulaceae, in which it was first identified. In these plants, the stomata (singular, stoma), specialized openings in the leaves of all plants through which CO2 enters and water vapor is lost, open during the night and close during the day. This model of stomatal opening and closing is the opposite of that in most plants.

You might be interested in
Dessert are only found near the equator t or f
rosijanka [135]

False. there are some at the equator but, some are found else where.

6 0
3 years ago
I need help.
likoan [24]
"Living things include plants, animals,bacteria, fungi and more. The non living parts of an ecosystem are called the a ABIOTIC FACTORS. In an ecosystem factors are sunlight, temperature atmospheric gases water and soil. Biotic factors are living components of an ecosystem
4 0
4 years ago
Explain why most volcanoes are found at plate boundaries
Dominik [7]
Magma rises up from the mantle through the gap between the plates as they move. 
8 0
4 years ago
Read 2 more answers
Points give a answer
stiks02 [169]

Answer:idk

Explanation:

6 0
3 years ago
Read 2 more answers
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
Other questions:
  • What is the main influence of Earth's climate?
    15·1 answer
  • PLZ HELP FAST<br><br> Which factor can decrease the kinetic energy of an object?<br><br> THX
    12·1 answer
  • Use the cladogram about fish to answer the
    8·2 answers
  • Is a protein a monomer or a polymer
    14·2 answers
  • What type of hair cell damage in cochlear implant?
    11·1 answer
  • What factor does not contribute to the limited vegetation in the tundra? A) limited carbon dioxide supply B) nutrient poor soil
    11·2 answers
  • Which refers to the rate of change in velocity?
    13·2 answers
  • Consider the following scenario: A drought hits the habitat of a semi-aquatic bird population. All ponds dry up, and fish popula
    5·1 answer
  • If you look at the diagram, there is no pathway for sedimentary rock to become igneous rock without first being metamorphosed. W
    9·1 answer
  • you have stumbled on a new species of fly (order diptera), and being a geneticist, you have already identified a few genes and o
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!