False. there are some at the equator but, some are found else where.
"Living things include plants, animals,bacteria, fungi and more. The non living parts of an ecosystem are called the a ABIOTIC FACTORS. In an ecosystem factors are sunlight, temperature atmospheric gases water and soil. Biotic factors are living components of an ecosystem
Magma rises up from the mantle through the gap between the plates as they move.
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'