1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
3 years ago
15

Where do the high energy electrons go to once they are excited?

Biology
2 answers:
Flauer [41]3 years ago
3 0

Electrons are the negative charged particles of the atoms. Electrons circle nucleus which contains the protons and neutrons
erma4kov [3.2K]3 years ago
3 0

When an excited electron inside a LED gives up vitality it must do so in those protuberances called quanta. These are settled bundles of vitality that cannot be changed or utilized in divisions; they must continuously be exchanged in entire sums. An excited electron has no alternative but to grant off either 1 quanta or 2 quanta of vitality, it cannot provide up 1.5 quanta, or 2.3 quanta.

Glad to help ya!! :)

You might be interested in
Which of mendals laws does Epistasis conflict with
ankoles [38]

Answer:

It does not obey Mendel's law of dominance.

Explanation:

Epistasis is not complete dominance

3 0
3 years ago
Which intercellular communication type changes membrane permeability?
Debora [2.8K]
Question 1 is certainly D. and number 2 is B because it causes communication with the musicle!
7 0
3 years ago
What is the function of Coral?
Ganezh [65]

Answer:Functions of Coral Reefs: Coral reefs are important for many different reasons aside from supposedly containing the most diverse ecosystems on the planet. They: protect coastlines from the damaging effects of wave action and tropical storms. provide habitats and shelter for many marine organisms.

6 0
3 years ago
1.which of these is not a basic need of all organisms?
m_a_m_a [10]
A. soil
a. stimulus
b.carbon
b. as a single cell
7 0
3 years ago
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Other questions:
  • How does volcanic activity cause climate change?
    10·1 answer
  • Why is this relationship shown as a cycle?<br><br><br> THIS IS SCIENCE<br><br> Thank You!
    12·1 answer
  • How does a mutation in a sex cell affect an organism? A. It stops the organism from making proteins. B. It prevents the organism
    6·2 answers
  • During photosynthesis plants take in light energy from the sun carbon dioxide from the air and water through their roots. Which
    11·1 answer
  • What describes the cell?
    12·1 answer
  • What type of bond is shown below, where electrons are shared between the bonded atoms?
    9·1 answer
  • What type of organic molecule comprises the majority of a potato? Monosaccharides
    14·1 answer
  • A strain of Drosophila known as dunce produces one-half the amount of cAMP phosphodiesterase found in wild-type flies, which cau
    10·1 answer
  • The electrons that travel through electron transport chain #1 (and that have been excited off of the chlorophyll molecules on ph
    8·1 answer
  • Which female golfer was the first to play against men in a pga tour event?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!