1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandr82 [10.1K]
3 years ago
13

Hi! please help i’ll give brainliest

Biology
2 answers:
RideAnS [48]3 years ago
7 0

Answer:

the open ocean

Explanation:

Neko [114]3 years ago
3 0

Answer:

An Ocean Shore

Explanation:

The wind would erode and deposit sand from dunes, and the water from the waves will erode rocks.

You might be interested in
Which hominid used skins and mats woven from leaves to collect fruit, berries, and seeds?
Gre4nikov [31]
The hominid that used skins and mats woven from leaves to collect fruit, berries, and seeds is the homo habilis. The homo habilis is a species of the tribe Hominini and one of the earliest members of the genus Homo. Homo habilis are also known as the "handy man" or "able man". 
8 0
4 years ago
Read 2 more answers
What is Rodenticide?
Helen [10]

\huge\underline\bold\red{what\: is\: \:rodenticide ?}

{\fcolorbox{red}{black}{\orange{AnsWer}}}

\underline\bold\green{A \:pesticide.}

3 0
3 years ago
Both ancestral birds and ancestral mammals shared a common ancestor that was terrestrial. Today, penguins (which are birds) and
nignag [31]

Answer:

The bones in the forelimbs of penguins and seals are homologous and the flippers in penguins and seals are analogous.

Explanation:

The flippers of penguins and seals are analagous because they have similar functions but they did not come from the same evolutionary origin. Their separate ancestors evolved them to cope with their respective environments. However, the bones in the forelimbs of penguins and seals are homologous because they both inherited their forelimbs from common ancestors with the same bones in their forelimbs.

5 0
3 years ago
What is the "evolutionary synthesis"?
nika2105 [10]

Answer:

A unified theory of evolution that combines genetics with natural selection.

7 0
3 years ago
Nuclear accidents are among the most feared disasters. The radioactive materials released can contaminate land and water, making
kvasek [131]
You will inherent skin burns and ulcers when exposed to the radiation. 


in other words the correct answer is C. 
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which question can be answered using the scientific process?
    13·2 answers
  • In sordaria, how many different chromosomes arrangements can be produced through independent assortment?
    8·1 answer
  • In order to insert a human gene into a plasmid, both must ____
    15·1 answer
  • Which type of speciation occurred among the Galapagos Islands finches?
    8·2 answers
  • Which of the following are limiting nutrients?<br> Water<br> Carbon<br> Nitrogen<br> Phosphorous
    10·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Plants use water, carbon dioxide, and sunlight to make oxygen, water, and what other product
    9·1 answer
  • F Write any functions of collenchyma tissue​
    13·1 answer
  • Select which of the following are mechanisms used by pathogens to avoid host defenses and to successfully colonize the host.
    12·1 answer
  • Name any five natural and five human-made changes around us.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!