1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fredd [130]
3 years ago
10

What happens to a sedimentary rock after tectonic plates push upwards? What would it turn into?

Biology
1 answer:
RUDIKE [14]3 years ago
7 0
A. Sedimentary rock is the answer
You might be interested in
Whst is the correct term for an area of rotating current in a ocean​
Kaylis [27]

Answer:

A gyre is a large system of rotating ocean currents.

Together, these larger and more permanent currents make up the systems of currents known as gyres.

Explanation:

3 0
4 years ago
Read 2 more answers
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Why are the surface winds moving toward the area where air is moving up?
lianna [129]
Well the forces are canceling out of eachother making the wind propel straight up instead of down which that surface is upside down?
5 0
3 years ago
Which organism would be the secondary consumer in this food chain? leaf insect bat cat
pogonyaev
The bat is the most qualified in being the secondary consumer. Cat eats bat, bat eats insect, insect eats leaf.
7 0
3 years ago
Read 2 more answers
pairing of homologous chromosomes at metaphase of meiosis i appears to be critical for proper alignment, crossing over, and subs
garik1379 [7]
The correct answer for the question that is being presented above is this one: "d. A special function of the spindle apparatus forces X and Y together."

Here are the following choices:
<span>a. They do share short homologies at their respective tips.
b. They use a unique sex-linked mechanism not present in other pairs.
c. They do not need to pair because they are not a homologous pair.
d. A special function of the spindle apparatus forces X and Y together.</span>

8 0
3 years ago
Other questions:
  • The parasympathetic nervous system is characterized by ____ preganglionic neurons and ____ postganglionic neurons.
    11·1 answer
  • The illustration depicts five types of intercellular chemical signals. what kind of signal does "e" represent?
    8·1 answer
  • How has the study of mitosis affected scientists' knowledge of cancer
    6·1 answer
  • Ron is observing an onion cell on a slide on the microscope he sees chromatic being pulled to opposite ends of the cell which ph
    5·1 answer
  • Aldosterone (a steroid hormone) is a small, nonpolar, hydrophobic molecule that enters a target cell by moving across the plasma
    5·1 answer
  • Collecting research data is the final step in the scientific method.<br> true or false
    11·1 answer
  • Which is the proper order of structures that contact the substances removed from the blood?
    6·1 answer
  • Compose a report about three careers in genomics. In your report, answer the following questions:
    10·1 answer
  • Describe one advantage prokaryote have over eukaryote cells?
    8·1 answer
  • What was the purpose of Mendel's experiments with dihybrid crosses?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!