1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lara31 [8.8K]
3 years ago
15

If the sequence of bases in one strand of dna is attcgac, what will be the base sequence on the strand that is formed during rep

lication?
Biology
1 answer:
Fynjy0 [20]3 years ago
5 0
Taagctg would be the replication strand, A always pairs with T and C always pairs with G, so replication strands just have the opposite base as the original strand 
You might be interested in
Is a modular growth strategy better for capturing concentrated resources or widespread (dilute) resources? Briefly explain your
GalinKa [24]

Answer:

The modular type of strategic techniques are highly modular in their working and can be very useful for capturing concentrated resources or widespread (dilute) resources. The modular design in a capturing technique enhances the chances of better resource capturing whether it is concentrated or diluted.

The modular design works like it has several hands, that can perform all of their work by own greatly decreasing time required for capturing.

8 0
3 years ago
Whats the answer to the photo below?
Stolb23 [73]

Answer:

I think its b

Explanation:

but am not 100% sure

8 0
3 years ago
Read 2 more answers
Which colors of the visible spectrum is absorbed by chlorophylls a and b?
Nookie1986 [14]
The color it should be absorbed by Chlorophylls is Orange & Red
5 0
2 years ago
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
When does cell division occur once
tino4ka555 [31]
I think your answer is mitosis
3 0
3 years ago
Other questions:
  • Which of the following is the type of epithelium that lines the urinary tract? A. Stratified B. Columnar C. Transitional D. Cubo
    15·2 answers
  • Explain whether a conformer or a regulator could tolerate a wider range of conditions.
    5·1 answer
  • Does this look right????
    12·1 answer
  • In the United States there are strict fishing seasons and limits, but not all countries enforce similar laws. In Bangladesh ther
    11·1 answer
  • In what cell phase(s) does chromosome production (replication) and formation (condensing) occur?
    12·2 answers
  • The diatoms have flat geometric shapes and chains so they can increase their surface area. This will help them ? *
    5·1 answer
  • What cell types is a haploid
    7·1 answer
  • Write Significance of Transportation ?​
    6·2 answers
  • A nurse is reviewing blood work for a child with a cyanotic heart defect. what result would most likely be seen in a client expe
    5·1 answer
  • What specific changes in rachel’s muscle cells and kidney function are leading to elevated plasma k levels?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!