1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
3 years ago
14

What happens when then the rabbits populations increased?

Biology
1 answer:
Bingel [31]3 years ago
7 0
Well there will be an abundant as of rabbits. It becomes a problem when there is no predator to hunt them. If there is an over-abundance without a predator it many cause other species such as plants to become endangered. In conclusion, a balance in the ecosystem is vital.
You might be interested in
Even healthy people can be affected by high levels of ozone near the ground.<br> True or False
hoa [83]

The answer would be true.

3 0
3 years ago
Katya listed major questions that scientists try to answer when they classify organisms. Her list included the following questio
IrinaK [193]

Answer:

D) How do living things get energy?

G) How are living things related?

F) Where do living things make their home?

Explanation:

Different types of organisms are present on this Earth which interact with both abiotic and biotic factors and influence the nature of the environment. So there is a need to study the living organisms in which the first thing is to arrange the living organism by a process called classification.

The questions that are necessary to classify the organisms include related to the mode of energy or nutrition, the relation between various species at the morphological and molecular level, the habitat. The relationship between the organism is a very important aspect as it makes the classification easily according to their similarities and dissimilarities.

Thus, the selected options are the correct answer.

7 0
4 years ago
What is usually responsible for an earthquake?
Leokris [45]
Movement in the tectonic plates of the earth's crust
6 0
3 years ago
Read 2 more answers
you are attemping to identify two mystery metals. explain what properties would be helpful be helpful in identifying them and ho
Viefleur [7K]
You would look for the chemical and physical properties because by identifying what properties those metals fit into it is easier to compare and contrast what metal they are
4 0
3 years ago
What are the differences between density-independent and density-dependent limiting factors?
erica [24]

Density independent means that the limiting factors are not dependent on the number of individuals in the population. For example, an earthquake will kill individuals in a population no matter if the population is large or small.

A density dependent limiting factor means that the effect is dependent on how many individuals there is in a population. For example, a disease will have greater effect in a large population since it would be spread to more individuals.

7 0
4 years ago
Other questions:
  • List the five characteristics a substance must have to be a mineral. Explain why coal and a glass marble are not minerals.
    14·1 answer
  • Kari is having lunch with a friend who has been just diagnosed with cancer. what kind of listening is likely to occur?
    8·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • Natural gas is very common in the United States. Natural gas forms in processes taking thousands of years. So, Natural gas is
    8·1 answer
  • 5) A white flower is crossed with a homozygous red flower (red is dominant).
    6·1 answer
  • In the human respiratory system, gas exchange occurs across the cells of the ________.
    5·1 answer
  • The simplest tree using the fewest changes to show evolutionary relationships within a cladogram *
    8·1 answer
  • Ball and socket joints allow bones to move _____.
    6·2 answers
  • No question here my bad &lt;3
    7·1 answer
  • Although they are different species, woodpeckers and squirrels both live in holes in trees. what resource are these species comp
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!