Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
I think the correct answer from the choices listed above is option D. Modern fishing practices threaten biodiversity mainly through the removal of community food supplies. When people remove a significant amount of fish, portions of the food web are disturbed and can affect a certain ecosystem.
The answer is: two cells
Explanation:-
At the last stage of mitotic division (telophase) the cell will divide into two cells
Answer:
they're valuable because it takes a long time for the soil to be rich with nutrients, so there's a liter amount of it.
Answer:
All of the choices are correct
Explanation:
A person suffering a generalized bacterial infection has the following desirable general characteristic of antimicrobial drugs such as;
- Selective toxicity
- Bactericidal rather than bacteriostatic - Broad-spectrum of activity.