1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ulleksa [173]
3 years ago
10

Why do living things store energy in lipids instead of carbohydrates??

Biology
1 answer:
anzhelika [568]3 years ago
4 0
Because lipids are fat cells and it is a much easier way to get energy.
A camel has a fat hump because that is it's source of energy <span />
You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What are cumulonimbus clouds?
Mazyrski [523]

Explanation:

Cumulonimbus clouds are a type of cumulus cloud associated with thunder storms and heavy precipitation. They are also a variation of nimbus or precipitation bearing clouds. They are formed beneath 20,000 ft. and are relatively close to the ground. ... These clouds often produce lightning in their heart.

7 0
3 years ago
Many psychologists are suspicious of memories retrieved through hypnosis because:
GenaCL600 [577]
The answer is: Because a subject might involuntarily manufacture a false memory and believe it is true.






Hope this help ❤️
4 0
3 years ago
Earth was formed approximately 4.6 billion years ago. true false
GaryK [48]
That is a true question

5 0
3 years ago
Electrical devices that has sound energy as an output
Margaret [11]
<h2>Answer with Explanation </h2>

The speaker and transformer are the devices that consume the electrical energy and release the sound as an output in this process the phenomena which are acquired is electromagnetic induction. The sound energy can also be converted into the electrical energy but fir this process high temperature and high frequency is required. The sound energy is important as it informs us about the character, place and time.

8 0
3 years ago
Other questions:
  • The lowermost portion of the atmosphere where most weather occurs is called the:
    5·1 answer
  • If the sperm gamete that fertilizes an egg has a(n) _____ chromosome, it will form female offspring. X Y XY XX
    9·2 answers
  • What are the two main functions of chloroplasts
    14·1 answer
  • Que es un eucariota
    14·2 answers
  • HELP!!! URGENT!!!! How does the solar radiation affect the water cycle?
    10·1 answer
  • What makes MSA growth media selective for Gram<br>​
    15·1 answer
  • Name the gametes a pea with the genotype Gg makes Group of answer choices
    13·1 answer
  • Investigator Murray is examining evidence from an old crime scene. She has a blood sample, but she believes that the sample may
    9·1 answer
  • Which of the following components of an ecosystem are not abiotic factors?
    11·2 answers
  • The first living thing to grow successfully on a newly formed sand dune are known as?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!