Its found in the body's tissues.
Hope that helps. I can give a more detailed answer if you need one. <span />
Answer:
<h2>C, RANGLELAND</h2>
Explanation:
Rangeland can be described as a land which consists of grasses, shrubs, woods, wetlands etc which are ideal for the grazing of domestic and wetland animals. Hence, a rangeland is used for grazing livestock. Hence, option C is correct.
Other options, like option D, is not correct because an urban land supports city life. It is not ideal for the growing of crops as it contains pollution of the city.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
