Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Oh boy, there's many, many, many, many...
(many x100)
many ways!
One way is to take shorter showers and conserve water wherever you go, at home, at a restaurant, hotel, etc.
Another way is to not litter on the streets.
Or, spread the word and tell everyone to conserve water, not litter, or just anything to help the environment!
The image below may help you (ʘᴗʘ✿)...
Answer is Anemia, which is the absence of a good portion of red blood cells.
Plants and some types of archaea or bacteria use photosynthesis to create food.