Answer: will either absorb or release energy,
Explanation:
As a phase change occurs, they will either absorb or release energy, which is being transferred into or out of the phase change material. So thermal energy itself doesn't necessarily change location. When this happens thermal energy is either absorbed or released. When it's absorbed enough, the object melts.
Answer:
Forensic entomology also helps determine an estimate of how long a person or animal has been deceased or the Post Mortem Interval (PMI). Investigators can determine this from insects by studying the development of the insect. An adult insect will fly around until it finds a body that is suitable for it to lay its eggs.
Explanation:
Answer:
autotrophe supply food for the hetertrophe
Explanation:
give brainliest please I need it to level up
Answer: 3.
Explanation:
Premature loss of weight does not indicate cure of type 2 diabetes.
The loss of weight shows removal of excess glucose in the blood by exercises.
Therefore the patient need to be informed that inorder to sustain the glucose threshold levels of the blood to avoid hypoglycemia,which may be damaging,insulin intake should not be stopped.
Insulin intake should continue with the exercise. To provide glucose to cells of the body,while removing excess glucose that could not penetrate the cells.
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"