All categories

3 years ago

1. One literary critic commented that "Ionesco shows us how we became Nazis".

2 answers:

tatiyna3 years ago

8 0

The sentence from rhinoceroses that best supports this view is: It is obvious that one must not always drift blindly behind events and that it's a good thing to maintain one's individuality. The answer to your question is C. I hope that this is the answer that you were looking for and it has helped you.

egoroff_w [7]3 years ago

8 0

1.)C

It is obvious that one must not always drift blindly Behind events and that is a good thing to maintain ones individuality

2.)C

The characters communicate a theme of hope for mankind

3.)B

Those who were recruited into nazism

4.)A

Correct

5.)D

That book is set to release

You might be interested in

Explain how thermal energy is involved in changes of state

Julli [10]

Answer: will either absorb or release energy,

Explanation:

As a phase change occurs, they will either absorb or release energy, which is being transferred into or out of the phase change material. So thermal energy itself doesn't necessarily change location. When this happens thermal energy is either absorbed or released. When it's absorbed enough, the object melts.

6 0

2 years ago

If beetles are found around a body this indicates that thw body has been dead for how many hours?

sladkih [1.3K]

Answer:

Forensic entomology also helps determine an estimate of how long a person or animal has been deceased or the Post Mortem Interval (PMI). Investigators can determine this from insects by studying the development of the insect. An adult insect will fly around until it finds a body that is suitable for it to lay its eggs.

Explanation:

8 0

4 years ago

Help is very much appreciated

Vaselesa [24]

Answer:

autotrophe supply food for the hetertrophe

Explanation:

give brainliest please I need it to level up

6 0

3 years ago

The nurse is teaching a client with type 2 diabetes about the importance of weight control. Which comment by the client indicate

Troyanec [42]

Answer: 3.

Explanation:

Premature loss of weight does not indicate cure of type 2 diabetes.

The loss of weight shows removal of excess glucose in the blood by exercises.

Therefore the patient need to be informed that inorder to sustain the glucose threshold levels of the blood to avoid hypoglycemia,which may be damaging,insulin intake should not be stopped.

Insulin intake should continue with the exercise. To provide glucose to cells of the body,while removing excess glucose that could not penetrate the cells.

4 0

4 years ago

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′

Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

4 0

4 years ago