1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
3 years ago
11

Tara has two dogs. They win many of the agility competitions they enter. These competitions test a dog's ability to

Biology
2 answers:
monitta3 years ago
4 0

Answer:

B

Explanation:

ololo11 [35]3 years ago
3 0

Answer:

O With training, the puppies are likely to excel at agility competitions.

O Without training, the puppies are no more likely to succeed at agility competitions than any other dog.

Explanation:

This two options speaks the same thing and are the correct option.

The phenotype of an organism is a product of genotype and environment

P=G+E

The litters can inherit the trait of running, having a good vigour and ability to win agility competition but when the environment do not allow this trait to be expressed the trait can be masked i. e may not find expression.

The environment ensure that this litters are been taught the rudiment of agility competition to ensure they win if they are not been taught, they many not know they have the ability to win and will not be different from other dogs.

The training is what brings out the potential in them that can later be seen and expressed in the competition.

You might be interested in
How does the concept of a circle relate to cyclins?
baherus [9]

The progression of a cell by the cycle of cell is regulated by the protein family Cyclic

Explanation:

  • In the year 1982, Cyclin was located by Timothy Hunt as a family of proteins which has a vital function in the progression of a cell.
  • CDK enzymes or ‘cyclin dependent kinase’ gets activated by it that synthesizes the cycle of the cell.
  • The concentration of this protein moves in a cyclic way in the cell cycle. No enzymatic function is seen in them but it aims at CDK’s different location.

5 0
3 years ago
How do primary air pollutants differ from secondary air pollutants
mamaluj [8]
A primary air pollutant is directly from the source and secondary pollutants are omitted from two or more different primary pollutants interact with each other in the atmosphere.
EX of primary: carbon monoxide, nitrogen oxide, sulfur oxid
EX of secondary: NO2 acid rain
3 0
2 years ago
Why is diffusion important important to cells?
nekit [7.7K]

it allows for nutrients to come into the cell using passive tranport aka moving anything on a gradient without the use of energy (ATP).

6 0
3 years ago
Read 2 more answers
Which of the following statements regarding human cells are true? Check all that apply.
lana66690 [7]

Answer:

  • Human growth and functioning can be explained by the functioning of the cells.
  • Cells are the fundamental units of humans.
  • The functioning of the cells in the body determine human health.

Explanation:

The cell is the basic unit of life. Therefore the biochemical activities of the cell at a micro-level will definitely influence overall physiology at the macro level of an organism. For example, the production of Thyroid hormone at the molecular level by the cells in the thyroid glands will influence the metabolisms of all cells in a human being and therefore affect the organism’s overall growth and development.

7 0
3 years ago
A 6-month-old girl is taken to emergency department in January suffering from profuse watery diarrhea and vomiting. She has had
kati45 [8]

My diagnosis in this case is that the 6-month-old girl suffered from the infection caused by the virus called rotavirus.

<h3>What is rotavirus?</h3>

A rotavirus belongs to the genus within the family of virus called Reoviridae. They are made up of a double capsid and a double-stranded RNA genome.

The symptoms of this virus include:

  • watery diarrhea,

  • nausea and vomiting,

  • low-grade fever.

Therefore, the correct diagnosis should be that the 6-month-old girl suffered from the infection caused by the virus called rotavirus.

Learn more about virus here:

brainly.com/question/17395741

#SPJ1

5 0
1 year ago
Other questions:
  • Flowers usuany contain more stamen than pistils. Why do you think this is?
    11·1 answer
  • A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the sigma factor. the mutant bacteria p
    6·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What do water molecules do when water is a solid?
    5·1 answer
  • A mutation that can be inherited by offspring would result from A) random breakage of chromosomes in the nucleus of liver cells
    15·1 answer
  • Once mRNA is made it travels
    9·1 answer
  • Normal hemoglobin
    15·1 answer
  • Use the gel electrophoresis results below to determine which person (if any) is the father of the child.
    12·1 answer
  • Which type of cell is pictured on the right?<br> V eukaryoticy<br> COMPLETE
    6·1 answer
  • Im from phillippines can you be my b f.​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!