1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet-ann [11.9K]
3 years ago
7

Which level of classification includes the most species

Biology
2 answers:
NARA [144]3 years ago
8 0

Answer:

Domain is the highest level of classification.

evablogger [386]3 years ago
5 0

Answer: Domain

Explanation:

You might be interested in
If you were standing on the beach at midnight, would you feel a sea breeze or a land breeze? sea breeze land breeze
ad-work [718]
Land breeze.
Because a land breeze is usually early in the morning and late an night.
3 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Which layer of the earth is made out of melted metal?
romanna [79]

The outer core. A molten nickle- iron alloy.

5 0
2 years ago
What are the smallest unit of living matter ?
mina [271]
A cell is the smallest unit of living matter
6 0
3 years ago
What is the largest flower in the world?
kykrilka [37]

Answer:

<u>Rafflesia arnoldii</u>

Explanation:

The flower with the world's largest bloom is the Rafflesia arnoldii. This rare flower is found in the rainforests of Indonesia. It can grow to be 3 feet across and weigh up to 15 pounds! It is a parasitic plant, with no visible leaves, roots, or stem.

8 0
3 years ago
Other questions:
  • Plant and animal cells contain many of the same structures, and those structures carry out the same functions in both types of c
    14·1 answer
  • What type of organism are frogs in example of?
    12·2 answers
  • Which organelles are involved in cell reproduction
    5·1 answer
  • Which body of water is found in the east of Costa Rica? a. the Pacific Ocean c. the North Sea b. the Atlantic Ocean d. the Carib
    11·1 answer
  • A student heats a test tube containing a large amount of protein and notices a colour change. Why does heating causes colour cha
    11·1 answer
  • Which sequence below would result in the production of a protein?
    6·2 answers
  • 20. Name and describe two diseases caused by recessive genes.​
    14·2 answers
  • How does the light reaction of photosynthesis affect earth's supply of oxygen?
    13·1 answer
  • Recall the Jagendorf experiment (pasted below) was conducted wholly in the dark. Hypothesize what would happen if you were to mi
    9·1 answer
  • A central vacuole forms from
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!