1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]3 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
The endosymbiotic theory opposes that mitochondria in eukaryotic cells arose from
Ratling [72]

The endosymbiotic theory opposes that mitochondria in eukaryotic cells rose from C. Endosymbiotic prokaryotes that metabolized oxygen.

6 0
3 years ago
Leishmania is a protozoal parasite are transmitted by the bite of infected female sandflies. they are then phagocytized and live
qaws [65]

The answer is macrophages. They either actively invade these leukocytes or are phagocytosed, divide in the cells and cause lysis. The promastigotes that invade these leucocytes are transformed into amastigotes in the macrophages. These amastigotes continue attacking other healthy macrophages while others migrate to the mid gut.






8 0
3 years ago
Read 2 more answers
If a person has a painful, bleeding injury to the nose, should aspirin be given to help? Why or why not?
sattari [20]

No, you should not give aspirin to a person if the have a painful, bleeding injury to the nose.  Because aspirin thins the blood and cause you to bleed that much more.  

3 0
3 years ago
Read 2 more answers
Marine biology
sergey [27]

Answer:

The subphylum Chelicerata (New Latin, from French chélicère, from Greek χηλή, khēlē "claw, chela" and κέρας, kéras "horn")[1] constitutes one of the major subdivisions of the phylum Arthropoda. It contains the sea spiders, arachnids (including scorpions, spiders, and potentially horseshoe crabs[2]), and several extinct lineages, such as the eurypterids.

7 0
3 years ago
Read 2 more answers
What determines the type of feedback? A. How close to equilibrium the characteristic is B. How the body responds to a change C.
Leto [7]

Answer:

The awnser is B

Explanation: no explanation

5 0
2 years ago
Other questions:
  • Writers often use description to create a mood or establish a theme. What theme does Woolf establish in the opening paragraph? t
    8·1 answer
  • Which of the following behaviors is not a result of seasonal changes?
    14·2 answers
  • Explain the process behind the scientific method and how it has the potential to lead to a "feedback loop"
    10·1 answer
  • "_____ championed the position called constructivism."
    11·1 answer
  • **15 POINTS!!** A strand of DNA with the sequence A A C T T G will have a complimentary strand with the following sequence:
    9·2 answers
  • An _____ image cannot be projected and forms where light rays appear to originate
    12·1 answer
  • Considering an X-linked dominant trait, if an unaffected woman and an affected man decide to have children, which of the followi
    7·1 answer
  • ok so I'm reading about the martian (Mark Watney) and I need help to summarize chapter 6 could anyone please help?​
    5·1 answer
  • I need help with this fast plz<br> write the meaning of the words
    9·1 answer
  • A student wants to find out if a particular kind of plant grows better with or without potting soil. She has two identical plant
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!