1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
2 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]2 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
the type and age of rocks found in this mountain range are also found on another continent. what might this mean?
ki77a [65]
It means a continental drift occurred
6 0
3 years ago
1. In what ways have non-native species been beneficial?
12345 [234]

Hi

Please find answers in attached file.

Hope it help! :)


Download docx
7 0
3 years ago
17. A diagram of the electromagnetic spectrum is shown.
Nata [24]

Answer:

B

Explanation:

4 0
2 years ago
Read 2 more answers
An ecologist who is studying the relationships among the dominant communities in a geographical region is studying a biome. plea
navik [9.2K]
It is true that a<span>n ecologist who is studying the relationships among the dominant communities in a geographical region is studying a biome.
A biome is a group of ecosystems that have the same climate and similar dominant communities, so you can see that the answer to this question is T.</span>
3 0
3 years ago
Read 2 more answers
Our customers dogs have many different dietary needs, such as low-protein foods for kidney disease, and some of our customers si
Kruka [31]
In order to be sure you are always have enough of the right food in hand and get the best prices, in a situation in which customer dogs have many different dietary needs, and a lot of vendors on the other hand, you should use<span> a supply chain management system (SCM) to track vendor information, food usage trends, and food expiration. With SCM you will manage the flow of goods.</span>
4 0
3 years ago
Other questions:
  • What would happen to a plant cell during a period of severe drought?
    7·2 answers
  • What is the definition of microorganism
    12·2 answers
  • How is a class system different from a caste system?
    9·1 answer
  • True or false? acquired immunity is passed from mother to child before birth.
    15·1 answer
  • A pathologist who wants to examine a patient's liver cells to determine if the mitochondria have an internal structural defect w
    7·1 answer
  • The corticobulbar motor tract begins in the _____ and ends in the _____. spinal cord, brainstem cortex, brain stem brainstem, sp
    9·1 answer
  • What type of gloves protects your hands from hazardous chemicals?
    8·1 answer
  • Part A<br><br>What are the student’s observations and inferences before he starts his investigation?
    13·1 answer
  • What is the speed of light times 90
    8·1 answer
  • Can someone help me with this?​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!