1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]3 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
Natural effects that cause global warming
Viktor [21]

Population , we breath , you breath CO2 is increasing , so stop breathing and die somewhere lol. (ok just kidding)

5 0
2 years ago
De acuerdo a lo visto en clases, de los siguientes elementos señale 3 que no pueden estar ausentes en una célula.
Rama09 [41]

Answer:

The nucleus, cell membrane and cytoplasm.

Explanation:

The nucleus, cell membrane and cytoplasm are three elements that cannot be absent in a cell because they are necessary for the survival of the cell. The nucleus controls and regulates the activities happening inside the cell e.g. growth and metabolism etc. Cell membrane acts as a wall to protect the inner part of the cell from the external environment as well as allows nutrients and gases inside and outside the cell. Cytoplasm serves as a medium for the conduction of nutrients and waste from on place to another and also for the medium for organelles in which they floats.

7 0
2 years ago
Which of the following is not a characteristic of biofilms?
Ksenya-84 [330]

your answer would be c) iron deficiency

6 0
3 years ago
2. What type of beef cattle operation is it where producers focus on genetic improvements
Vinil7 [7]

Answer: the answer is seedstock

4 0
3 years ago
What happens when cells grow out of control?
Alexus [3.1K]
Answer: Cancer is the uncontrolled growth of abnormal cells in the body. Cancer develops when the body's normal control mechanism stops working. Old cells do not die and instead grow out of control, forming new, abnormal cells. These extra cells may form a mass of tissue, called a tumor.
Explanation: I looked it up on safari
4 0
3 years ago
Other questions:
  • Is an involuntary muscle that has the striated appearance of skeletal muscle with dark and light bands along the length of its f
    14·1 answer
  • In which surgical wound category should a total abdominal hysterectomy be classified?
    12·1 answer
  • What are differences between meiosis and mitosis?
    5·1 answer
  • Why does cellular respiration add carbon dioxide to the atmosphere, but photosynthesis does not?
    13·1 answer
  • Provide the complimentary strand of dna that would be paired with this original strand a t t c g a c g
    5·1 answer
  • Cells that contain a full set of chromosomes,or pairs of each chromosomes are?
    7·1 answer
  • Is a plain the result of constructive forces, destructive forces, or both?
    12·2 answers
  • Hii! i’ll give brainliest pls help
    12·1 answer
  • Which terrestrial planet is cold, has a small atmosphere, and is known for having violent storms for weeks?
    10·2 answers
  • Which of the following does water pollution affect: surface water, ground Water, or ocean water?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!