1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]3 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
How does human evolution or natural selection relate to the susceptibility of diseases?
deff fn [24]
This relates because at first the human species are vulnerable to the new disease but as natural selection in human evolution occurs the human species will be able to overcome the disease and become invulnerable.
5 0
3 years ago
Which statement comparing examples of renewable and nonrenewable resources is true? A. Geothermal energy is a nonrenewable resou
marishachu [46]
I think c but I'm not sure
4 0
3 years ago
Read 2 more answers
Can someone please help??
kotykmax [81]

2. If i were a forensic scientistand was called to a crime scene to see if drugs were present in the crime scene iwould use different kind of test to help me determine this, like for examplespectrophotometry tests, Microcrystalline test, and Color test. Because all of these<span>tests would help me to determine if drugs were to be present in the crime scene</span>3.It's important forscientist to have as much information as possible about the place that the drugsubstance is found because many factors can contribute when identifying a type ofdrug and because there might of have been some other substances with the drugand this could affect identifying the drug substance
6 0
3 years ago
Describe the type of plants that serve as pioneer species, intermediate species, and climax community species in secondary succe
MissTica
In secondary succession, the pioneer species are plants that are adapted to exploit disturbances rather than bare rock. They typically include plants such as grasses, birch trees, and fireweed. Organic matter from the pioneer species improves the soil so other trees and plants can move into the area.
7 0
3 years ago
Agar is an important component of media because A. bacteria require agar to grow.
Alik [6]

C. Agar provides a solid surface for bacterial growth.

Agar is a substance obtained from red algae which when added to a culture media, provides a solid surface for the growth of bacteria. When the agar is not added then the culture media remains as the broth and when the agar is added then the broth gets solidified.

Agar is added 1.5-2% in the broth to get solidified. The growth of the bacteria depends on the amount of agar added. Agar is used for the growth of bacteria because it has gel like properties which holds the nutrients evenly and the bacteria can use it accordingly.

3 0
3 years ago
Other questions:
  • Where is the greatest biodiversity on earth found?
    6·1 answer
  • How do genetic mutations lead to genetic variation
    10·2 answers
  • Which of the following is an example of a chemical change?
    9·1 answer
  • When a ball is first dropped off a cliff in free fall, it has an
    9·1 answer
  • Number of offspring produced over a period of time​
    7·1 answer
  • Quiz
    13·2 answers
  • What is anticondon for AGC
    10·2 answers
  • What is the relationship between changing CO2 emissions and CO2 concentration?
    7·1 answer
  • Oh it okxndnemsmwmwmwnwnwnnajajajajaj
    13·1 answer
  • DOES ANYONE KNOW THIS ANSWER PLEASE
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!