1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
2 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]2 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
True or false: during stressful events, there is decreased blood supply to the skin, which results in "goose bumps."
Sonbull [250]
False.
In a stressful event, there will be a hormone released to the blood called adrenaline. Adrenaline hormone can prepare the body for fight or flight response. One of the effects of this hormone is making the muscle around hair called musculus arrector pili contracted. This contraction of the muscle is what causing the goosebumps. The decreased blood supply has no role in this event.
5 0
3 years ago
Can anyone help me with my homework
yanalaym [24]

Answer:

1) True

2) True

3) False

4) True

5)True

3 0
2 years ago
The kidneys control the amount of water, ions, and other substances in the blood.
Vilka [71]
True due to the hormones that act upon the kidneys Two examples being Antidiuretic Hormone (ADH) and Aldosterone 
ADH increases water permeability of the kidney tubules and Aldosterone decreases the Sodium in the urine and increases the Potassium. 

4 0
3 years ago
which body cavity is located inferior to the thoracic diaphragm and superior to the pelvic brim of the hip bones
AnnyKZ [126]
The answer is abdominal cavity ! hope this helped you :)
5 0
3 years ago
How might convection currents cause plate movement
Gnom [1K]

Answer: Mantles

Explanation: Mantles convection currents causes plate movement

7 0
3 years ago
Other questions:
  • Courtney and kenzie are doing an experiment to determine which fish food gives their fish more energy. they have two fish tanks,
    13·2 answers
  • Helllppppp ASAPPPP the person with the first answer will be marked the brainliest!!!!!
    15·2 answers
  • SA nodal cells are unique in that they exhibit autorhythmicity, meaning they are capable of depolarizing and firing an action po
    8·1 answer
  • What is called when two species interact with eachnother
    11·1 answer
  • Which of the following is an example of convenience sampling?
    13·2 answers
  • Which statement best explains why meiosis produces haploid cells rather than diploid cells?
    11·1 answer
  • 5. A pride of lions hunting a dazzle of zebras.
    13·1 answer
  • PLS HELP ASAP
    14·2 answers
  • Which of the following planets has the largest orbital radius compared to the others?
    7·1 answer
  • 2. What is the function of DNA and RNA?a.Store and transmit hereditary informationb.Provide the body with quick energyc.Help to
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!