1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]3 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
cual consideras que es el proceso mediante el cual se transforma los alimentos en energia para las celulas de nuestro cuerpo
Murljashka [212]

Answer: Please refer to:

El metabolismo es el conjunto de reacciones químicas que tienen lugar en las células del cuerpo para convertir los alimentos en energía. Nuestro cuerpo necesita esta energía para todo lo que hacemos, desde movernos hasta pensar o crecer.

Explanation:

Not sure but hope it helps.

3 0
3 years ago
You have a beautiful garden at home. On Sunday, you start budding your rose plant to make few more samples of rose plants to pla
wlad13 [49]

Answer:

It is possible to make this categorization as follows:

Roses = Class

Rose samples = instances

Explanation:

In a very direct and objective way, we can state that classes are models that define how a given situation will be handled, which methods will be used to manage it and the objectives that will be established in that situation. Instances, on the other hand, are elements taken from the interior of classes, which contain factors that make them up. Based on this, we can determine that, in the case of the above question, roses are classes and rose samples are instances.

3 0
3 years ago
Why is DNA replication (copying) described as semi-conservative?
Blababa [14]

DNA replication is said to be semi-conservative because of this process of replication, where the resulting double helix is composed of both an old strand and a new strand. ... Semiconservative replication would produce two copies that each contained one of the original strands and one new strand.

7 0
3 years ago
Read 2 more answers
Mary Sue is making caramel ice cream. In the first part of the process, she combines a cup of sugar and a cup of water in a sauc
Nostrana [21]
When the sugar melted. The sugar was a solid but the became a liquid. I'm pretty sure. :)
4 0
3 years ago
Read 2 more answers
Ripping up a piece of paper is physical change or chemical change?
eduard
Hello there!

Ripping up a peice of paper is considered physical change.

Physical change means its still the same, it just changed shape.

Chemical change cannot be changed back.

For ex) Burning paper.

Its a chemical change because it cant be undone

hope this helps!

~DL
3 0
3 years ago
Read 2 more answers
Other questions:
  • ​during aerobic exercises such as dancing, as glucose is used by the muscles, ____. a. ​slow-twitch muscles produce glucose anae
    6·2 answers
  • Please help answer yes or no
    10·2 answers
  • What are two examples of abiotic factors and biotic factors?
    10·2 answers
  • Know difference between mass and weight
    11·2 answers
  • As plates move past each other, stress builds up. What happens when this stress becomes too much?
    9·1 answer
  • Need help ASAP !!!!!
    14·1 answer
  • What refers to any instrument or weapon used in a death, such as a knife or firearm?
    11·1 answer
  • Approximately 75% of all breast cancers grow in response to
    7·1 answer
  • What are the four types of parenting styles?
    14·1 answer
  • Natural chemicals in the brain that produce effects similar to those of morphine and other opium-derived drugs are called.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!