1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]3 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
What is the effect of water temperature on corals from inshore and offshore reefs?
frez [133]

Answer:

When the water gets too warm, the algae can no longer live inside corals, so they leave. The corals then turn from green to white, called coral bleaching. Climate change has been causing the Earth's air and oceans to get warmer. With warmer oceans, coral bleaching is becoming more widespread.

Explanation:

6 0
2 years ago
4. Enzymes are (choose one) a. Lipids c. Proteins b. Carbohydrates d. Nucleic acids
hodyreva [135]
Enzymes are a type of protein
3 0
3 years ago
Read 2 more answers
With sleep deprivation, the levels of leptin __with sleep deprivation, the levels of leptin ________ and the levels of ghrelin _
Dvinal [7]

With sleep deprivation, the levels of leptin fall and the levels of ghrelin rise.

What is leptin ?

Your body secretes a hormone called leptin that aids in long-term maintenance of your normal weight. Your blood's concentration of leptin and how much body fat you have are intimately correlated. Despite the fact that your body has enough fat reserves, leptin resistance makes you feel hungry and make you eat more.

What is ghrelin ?

Small amounts of ghrelin are also released by the small intestine, pancreas, and brain. Ghrelin is primarily synthesized and released by the stomach.

To learn more about Ghrelin click on the link below:

brainly.com/question/7747313

#SPJ4

8 0
1 year ago
A 20 fluid oz. soda contains 201 calories. how many kilojoules does the soda contain?
algol [13]
  The relation between calorie and kilo joul is  

1Cal=4.184 Kj  

1 Cal--------------------4.184 Kj
201 Cal--------------------- X Kj  
X=201*4.184/1=840.98 Kj  
<span>20 fluid oz. soda contains 840.98 Kj</span>
7 0
3 years ago
Read 2 more answers
How will you ensure that ecological balance is maintained in your ecosystem?
posledela

Explanation:

Taking steps to reduce or eliminate pollution from nonpoint sources such as streets and farms will help to maintain the ecological balance. Sewage and run-off of agricultural fertilizer can cause the rapid growth of algae in lakes and streams. The growth of algae blocks sunlight and depletes the oxygen in the water.

4 0
2 years ago
Read 2 more answers
Other questions:
  • Unlike exoskeletons ,endoskeletons
    6·1 answer
  • How do environmental factors and heredity affect personal health?
    8·2 answers
  • Complete the following sentence:
    6·1 answer
  • Can you help me i will give you a branlist
    9·1 answer
  • What happens to a cell when it becomes cancerous ?
    7·2 answers
  • Why do you think analogous structures would cause Evolutionary biologists problems when trying to determine the relatedness of c
    14·1 answer
  • Plzzzz help i will give brainlyest <br><br><br> Write a paragraph describing silverback gorillas
    10·1 answer
  • What are important important factors in determining where hazards will occur
    8·1 answer
  • Outline the stages involved in the development of cancer ​
    15·1 answer
  • Which of the following best describes what happens during the phases of mitosis shown in the diagram?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!