1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]3 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
Which of the following fossil fuels influenced how people purchased goods in the 1800s?
Artyom0805 [142]
Coal was the driving force behind 1800s culture
4 0
3 years ago
Read 2 more answers
How many chlorine atoms are there in the molecule NiCl2
olchik [2.2K]

Answer:

2, that’s what the 2 means.

Explanation:

4 0
2 years ago
Archaebacteria are ______________ in nature.
morpeh [17]

Explanation:

Spherical is the answer

7 0
2 years ago
Read 2 more answers
Consider the human body systems in this unit. Each of these systems helps maintain one or more of the characteristics of life. P
Alexeev081 [22]
All you need to look through the human body systems you had in the unit and explain how they make you living, rather than dead. What body systems do you have that make you a living human being.
1. Your Cardiovascular system. It keeps your body and cells supplied with oxygen so they can stay alive.
2. Your nervous system. It allows your body to take outside stimuli and allow your brain to process and react to it.
3. Your Digestive system. It allows you to extract the energy from other living things and use it to power your body.
4 0
2 years ago
What elements are find in a high proportion in earths crust
-Dominant- [34]
<span>The elements that are found in a high proportion in Earth's crust are oxygen, aluminium, iron, calcium, potassium, sodium, and magnesium. But for your Option, I think it is B) Oxygen and Silicon. This is because Oxygen makes 46.6% while Silicon makes 27.7% of the Earth crust.</span>
8 0
3 years ago
Other questions:
  • What does the process of absolute dating determine?
    7·2 answers
  • The classification of species is what
    12·1 answer
  • How does random fertilization add to the genetic variation?
    9·2 answers
  • Brain blood flow autoregulation ________. a. is less sensitive to pH than to a decreased oxygen level b. causes constriction of
    13·2 answers
  • Define procedure in your own words​
    6·1 answer
  • The calm areas near the equator where warm air rises are___
    11·2 answers
  • How does RNA leader sequence affect Trp operon syst
    6·1 answer
  • The four stages of cellular respiration do not function independently. Instead, they function ______
    8·1 answer
  • Pls !<br> Help!<br> How does the length of interphase compare to the length of cell division?
    8·1 answer
  • Which feature separates humans from other primates?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!