1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]3 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
How do earths major ecosystems differ
lakkis [162]
What is this for is it biology
8 0
3 years ago
Read 2 more answers
Do you think it is possible to have the benefits of the agricultural & industrial revolution without the environmental costs
telo118 [61]
I do not think the industrial and agricultural revolutions could have occurred without the environmental costs. The industrial revolution in the 18th century occurred at a time in history when people where not aware of the consequences of their actions or the consequences of the widespread use of fossil fuels. Even if they were aware the technology would not have been present to harness power from natural renewable sources of energy. 
6 0
3 years ago
In order for proteins synthesis to acquire both transcription and translation must occur which of the following statements descr
pashok25 [27]
Answer: In transcription, the genetic code of a DNA molecule is encoded. Translation is the process of converting DNA Code into a code that RNA can use.
3 0
2 years ago
What does the word sex mean...
Vesna [10]

Answer: a specific gender

Explanation:

5 0
3 years ago
Read 2 more answers
Which process results in two daughter cells each having the same number of chromosomes as the parent cell?
Allisa [31]
DONT CLICK D!! i just took it and it was mitosis!!!! B is the correct answer!!!!!!!!!
5 0
3 years ago
Read 2 more answers
Other questions:
  • Weather balloons are often used to make measurements in which spear
    11·1 answer
  • Bone formation begins when ____________ secrete the initial semisolid organic form of bone matrix called ____________ .
    7·1 answer
  • Which biome has multistory communities?
    14·1 answer
  • How many factors should a well-designed experiment test at one time?
    8·1 answer
  • Disease or sickness is caused by microorganisms that grow rapidly between 41 and 140 degrees Fahrenheit. True or False
    6·1 answer
  • PLEASE ANSWER ASAP WILL MARK BRAINLIEST!!
    10·1 answer
  • What are the 2 main categories of cells?
    6·2 answers
  • Similar rock formations have been discovered in Brazil and South Africa. These rock formations were formed at the same time and
    14·1 answer
  • In which direction does air flow?
    6·1 answer
  • What do plants make through the process of photosynthesis
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!