1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
14

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

ase proceeds along this template from left to right. • Which end of the DNA template is 5’ and which end is 3’? • Give the sequence and identify the 5’ and 3’ ends of the RNA copied from this template.
Biology
1 answer:
quester [9]3 years ago
5 0

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

You might be interested in
Which of the following promotes closure of the minivalves associated with lymph capillaries?
Molodets [167]

Answer:

increasing pressure inside the lymph capillary

Explanation:

Lymph is a fluid like the blood which carry the White blood cells which can fight against the infection. The lymph flows in separate vessels called lymphatic vessels.

The lymphatic vessel is very thin-walled smooth muscle containing tube-like structure which allows the transport of lymph.

The lymph vessel like blood vessel contains the valves called mini valves which prevent the backward flow of the lymph.

When the pressure in the tiny lymph capillaries which supplies lymph to the organs increases, the mini valves closes to prevent backflow of lymph and is the mechanism of lymph flow.

Thus, the selected option is the correct answer.

6 0
3 years ago
The equation for the chemical reaction shown is not balanced. What number should replace the question mark to balance this equat
Evgen [1.6K]

The answer is C. In order to balance this equation you have to look at the 2AlCl3. The first Cl2 needs to equal 6 because 2x3=6. So the answer is 3.
7 0
3 years ago
PLEASE HELP ME FAST!
Archy [21]

Answer:Form a hypothesis

Explanation:

8 0
3 years ago
Read 2 more answers
Where are cell organelles located within the cell
Setler79 [48]
Cell organelles are located in the Cytoplasm of the cell

7 0
3 years ago
Which two sentences the characteristic of a prokaryot
Natali [406]

Answer: Prokaryotes lack an organized nucleus and other membrane-bound organelles. Prokaryotic DNA is found during a central a part of the cell called the nucleoid. The plasma membrane of a prokaryote acts as an additional layer of protection, helps maintain cell shape, and prevents dehydration.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which term represents the process of division of the cytoplasm at the end of mitosis?
    14·2 answers
  • The dictionary defines equilibrium as a situation in which forces
    8·1 answer
  • A primigravid client, age 20, has just completed a difficult, forceps-assisted delivery of twins. her labor was unusually long a
    10·1 answer
  • The use of Crizotinib to inhibit the activity of MET, a tyrosine kinase that is abnormal in a number of tumors.The use of Erbitu
    9·1 answer
  • 9. What are the major differences between P and S waves from an earthquake
    13·1 answer
  • How does nutrient enrichment cause chemical and environmental change that results in major shifts in animal life?
    14·1 answer
  • Help me immediately
    15·2 answers
  • WILL MARK BRAINLIEST IF CORRECT!!!!!!!!!!!!!
    8·1 answer
  • HELP! I will give you brainliest!!!
    15·2 answers
  • Australian dragon lizards have a ZW sex-determination system. The male genotype is homogametic (ZZ), and the female genotype is
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!