1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldfiish [28.3K]
3 years ago
7

Which of the following statements is true?

Biology
2 answers:
blagie [28]3 years ago
6 0

Answer:

C. capillaries connect arteries and veins.

Explanation:

A is false, veins carry blood towards the heart.

B is false because arteries are the thickest blood vessel.

C is completely true

D is false, heartbeat is controlled by electric impulses

Lynna [10]3 years ago
3 0
C

Capillaries connect the arteries to veins. The arteries deliver the oxygen-rich blood to the capillaries, where the actual exchange of oxygen and carbon dioxide occurs.
You might be interested in
A postmenopausal client is scheduled for a bone-density scan. the nurse should instruct the client to:
Svetlanka [38]
The client should remove all metal objects (such as piercings, rings, jewelry of any kind) the day of the scan. 
5 0
3 years ago
Read 2 more answers
State Mendel's law in genetics​
Monica [59]

Answer:

the inheritance of one pair of factors is independent of the inheritance of the other pair.

8 0
2 years ago
Read 2 more answers
What is the answer to this question
Alexxx [7]

Answer:

the larg one is 87 percent, the two mediums are 26 Percent, and the little one is 9 percent

Explanation:

no need to explain

8 0
3 years ago
Which of the following traits of land plants allows them to grow in height?
Alekssandra [29.7K]

Answer:

Trachieds

Explanation:

  • Trachieds are the cells in the xylem- vessels in plants that allow for transportation of water.
  • Trachieds are not perforated i.e they do not have pits like phloem does.
  • As a result of not being perforated trachieds make the xylem a very strong tissue which can withstand the force of water and hold the land plant up.
7 0
3 years ago
Compare and contrast the terms genotype and phenotype. Describe at least two ways that they are alike and two ways that they are
faltersainse [42]
Compare: They both are products of DNA. They both are equally important to a living organism. Contrast: Genotype is the genetic makeup, while Phenotype is the physical appearance. Genotype can't be seen but phenotype can.
4 0
3 years ago
Other questions:
  • The pre-teen years occur during the __________ stage, from 9 to 11 years of age.
    9·1 answer
  • Which of the following is not a sign of possible pest infestation?
    6·2 answers
  • How are bacteria classified?
    10·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What is the basic unit of structure in all living organisms
    13·2 answers
  • What causes an increase in the number and intensity of small earthquakes before an eruption?
    9·1 answer
  • A plant may open and close its stomata to prevent excess water loss and maintain _____.
    9·2 answers
  • A water molecule is
    8·1 answer
  • Answer true or false
    6·2 answers
  • Which statement best describes a characteristic unique to renewable resources?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!