1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
3 years ago
12

Please help with all of these quickly!

Biology
1 answer:
ololo11 [35]3 years ago
4 0
Sorry but you need more detail but i think you can find some answers on the fossil webs.
You might be interested in
PLEASE HELP!!
Fed [463]

Answer:

ancient astronomers could not recognize any planets. I'm pretty sure

7 0
3 years ago
You just wrote in the template strand of DNA. Use the template strand to transcribe a strand of mRNA.
mario62 [17]

Answer: the codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain. The anticodon is the complementary three nucleotide sequence in the appropriate tRNA. Template stand is the DNA strand off which the mRNA is synthesized.

Explanation:

8 0
3 years ago
A hypothetical light bulb is provided 450 kilojoules of electricity; however, 90 kilojoules of electric energy was wasted produc
andre [41]
None of the above because that the answers
8 0
3 years ago
Attend a basic first-aid course and explain how the information gathered in the course will be specifically helpful to you as a
nikitadnepr [17]

Answer:

The course of basic first-aid will be helpful for me because it prepares me for any kind of medical emergency, I could save lifes with knowing the correct technique.

Explanation:

Every medical emergency in which someone is in real death danger can involves that the patient´s heart stops and he/she stops breathing. On a basic first-aid course the experts teach us what to do in case that happens, in basic words, to keep the person alive until the ambulance arrives to take the person to a hospital.

First aid involves knowing how to cure a simple burnt to having the heart re-animated by using the needed equipment. They teach us how to to a proper CPR in case someone needs it and-more important- how to know when someone needs it.

Also, they prepar us for several emergencies, like choking with food, an allergy episode (how to use the anti-histamine shot), to keep a fracture well until the specialists arrive.

All this information will be helpful for me as a certified trainer because I will be prepared for any situation and most of all, I will be calm.

3 0
4 years ago
1. What kind of material can be found in our water?
GaryK [48]
I hope what they said helps!
7 0
3 years ago
Other questions:
  • What is the role of the nervous system in heartbeat regulation?
    8·1 answer
  • If a plant is living in a cold environment, which physiological change would help the most with the cool temperatures?
    7·2 answers
  • Improper hot holding and improper cooling are both examples of
    7·2 answers
  • For each of the following classes of proteins, give two examples of specific proteins.
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Why are small populations so much more likely to experience genetic drift
    10·1 answer
  • What is the next step in the scientific method following forming a hypothesis
    13·1 answer
  • 5. The scientific term for chewing food is
    14·2 answers
  • What is the atomic number of this atom?<br> a<br> b,c<br> O 8<br> 13<br> 09<br> . 5<br> 4.
    6·1 answer
  • If one person in 50 is a carrier of an autosomal recessive disorder in a population, the chance that an unrelated man and woman
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!