The mythbusters are trying to determine how different sounds affect plant growth

Biology

2 answers:

professor190 [17]3 years ago

8 0

The plants grow better than the control plants that received neither talk nor music

oksian1 [2.3K]3 years ago

6 0

Answer:

Music tends to help the plants grow faster and taller no matter the type

You might be interested in

The epigastric region is a portion of the cavity. multiple choice pelvic pleural vertebral abdominal

svetlana [45]

The epigastric region is a portion of the <u>abdominal </u>cavity.

The correct option is d.

The greatest hollow area in the body is the abdominal cavity. Its lower limit is the upper plane of the pelvic cavity, and its upper barrier is the diaphragm, a sheet of muscle and connective tissue that divides it from the chest cavity. The spinal column, as well as the abdomen and other muscles, encircle it vertically.

The epigastrium is the top portion of your abdomen that is immediately below your rib cage. The epigastrium houses your pancreas and the duodenum, a section of your small intestine. Additionally, your stomach and liver are partially located here.

To learn more about epigastric region, refer

brainly.com/question/28237650

#SPJ4

6 0

1 year ago

magine that the animal body produced sperm and eggs with mitosis instead of meiosis. What chromosome number would the autosomes

san4es73 [151]

Answer:

sixteen chromosomes

Explanation:

this is because the

4 0

3 years ago

Which of these geological features would most likely occur where tectonic plates move away from each other?

Ahat [919]

Hot spot volcano, hope this helps

8 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

What of the following is a characteristic of lactid acid fermentation

user100 [1]

It is milk because milk has lactose

8 0

2 years ago