Answer: Although the Moon appears to shine, it does not emit light. Instead, we can see the Moon because it is lit up by the Sun.
Explanation:
The part of the Moon that is both sunlit and facing Earth is called the Moon's phase.
As the Moon orbits Earth, the Moon's phase changes. The model below shows the Moon's phase at eight positions in its orbit. The smaller moons closer to Earth show where sunlight hits the Moon. The larger moons farther from Earth show how the Moon will look during that phase.
30
Step by steps explanation
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Not directly. Detectors can convert to a form that is visible to the human eye. Hope that helps
<span>carbohydrates ...................</span>