1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreyandreev [35.5K]
4 years ago
6

An observable feature or characteristic that is passed on from an organism in its genes is called a(n) _________________. Questi

on 3 options: simple trait inherited trait learned trait environmental trait Save Question 4 (1 point) Question 4 Unsaved A trait that is not passed on to an organism from its parents but is picked up during its lifetime is called a(n) ________________. Question 4 options: learned trait inherited trait genetic trait simple trait Save Question 5 (1 point) Question 5 Unsaved Genetics is the study of ____________. Question 5 options: Guinea pigs and their hair styles Heredity or the way that traits are passed down from parents to offspring Learned traits and the way people act Save Question 6 (1 point) Question 6 Unsaved True or False. The color of a persons eyes is a learned trait. Question 6 options: True False Save Question 7 (1 point) Question 7 Unsaved A dog shakes paws with you. Is this a learned or inherited trait? Question 7 options: Learned Inherited Save Question 8 (1 point) Question 8 Unsaved You speak English fluently. Is this a learned or inherited trait? Question 8 options: Learned Inherited Save Question 9 (1 point) Question 9 Unsaved Inherited traits are passed on from parents to offspring through their ___________. Question 9 options: knowledge genes money skin Save Question 10 (1 point) Question 10 Unsaved Which of the following is Gregor Mendel's big contribution to genetics? Choose the best answer. Question 10 options: Green color in peas is dominant over yellow DNA in cells carries genetic information. Organisms carry two factors for each trait and some of these factors are recessive and hidden. Learned traits are passed on in an organisms genes. Save
Biology
1 answer:
Hitman42 [59]4 years ago
7 0
1) Phenotype, or inhereted trait.

2) Learned trait

3) Genetics

4) False

5) Learned

6) No

7) Genes

8) First option
You might be interested in
Why do modern humans crave food that is high in fat and sugar
abruzzese [7]
These preferences may have been advantageous in our evolutionary history, when food was less reliably available

-from quizlet
8 0
3 years ago
Match the following. 1. period during the life of a cell when it has finished mitotic division G1 phase 2. period during the lif
zimovet [89]

Ans.

The cell cycle includes a series of events that results in the formation of daughter cells from a single parent cell. These events include interphase, followed by M phase. The interphase consists of three phases, G0 (Gap 0) phase, G1 phase, S (synthesis) phase, G2 phase, while the M phase consists two phases, karyokinesis (mitotic or meiotic phase) and cytokinesis. At the end of cell cycle, cell enters into G0 phase again and the cycle goes subsequently.

The sequesnce of cell cycle events can be written as follows:

G0→G1→S→G2→M→G0→G1→....

Thus, according to the cell cycle sequence, these terms can be matched as:

1. When a cell finishes its mitotic division, it enters to G0 phase, which is also known as rest phase. Thus, statement 1. matches with G0 phase.

2. The period between end of mitosis and synthesis of genetic material for next mitotic division shows G1 phase, in which cell prepares itself for division. Thus, statement 2. matches with G1 phase.

3. The period of interphase between synthesis of new genetic material and the beginning of mitosis is G2. Thus, statement 3. matches with G2 phase.

4. The period between two mitotic division is interphase. Thus, statement 4. matches with interphase.

5. The period of cell division, during which a cell is performing actual cell division is M phase. Thus, statement 5. matches with M phase.

6. The period of interphase, during which genetic material gets doubled is synthesis or S phase. Thus, statement 6. matches with S phase.


6 0
3 years ago
Read 2 more answers
What happens to the shell of an egg when placed in vinegar?
Murrr4er [49]

you can put a needle through it and it won't break.

8 0
4 years ago
Micronutrients are needed for _____.
IrinaK [193]
I think the answer is A
Hope this helps have a good night!
4 0
3 years ago
Enzymes antibodies and clotting compounds are made of
lys-0071 [83]
<span>Enzymes antibodies and clotting compounds are made of proteins, in which these proteins generally exist in different forms and a common example of it are the amino acids. To add up, these enzyme antibodies aids the immune system by serving as a catalytic antibody producing a hapten molecule.</span>
8 0
4 years ago
Other questions:
  • What are the requirements for photosynthesis to occur, and what is the role of ATP in this reaction?
    7·2 answers
  • What system includes oxygen, nitrogen, and ozone?
    13·2 answers
  • When mrp ii systems include feedback to revise a plan that is not feasible, they are known as?
    5·1 answer
  • If a cow has two stomachs then how much stomachs do horses have?
    7·2 answers
  • Which organelles do viruses posses
    13·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Why does the height of the cumulus cloud base change from day to day?
    6·2 answers
  • Formulate a question that could be answered observing chromosomes of different species of animals
    14·1 answer
  • Which of the following is not a difference between mitosis and meiosis?
    5·1 answer
  • HELPPP!!!! Which element is also an air
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!