1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeyben [28]
3 years ago
8

A material is biodegradable if?

Biology
1 answer:
BARSIC [14]3 years ago
5 0

<u>Answer</u>:-  A material is considered biodegradable if it can be broken down by biological processes.

<u>Explanation</u>:-

1. There are many living organisms such as bacteria, fungi and other microbes that feed on organic matter and convert them into simpler forms.

2. Due to the enzymes released by such microbes, all the materials such as food refuse, tree leaves, grasses etc. are considered to be <em>biodegradable </em>as they are capable of being broken down by them.

3. The materials that cannot be broken down by such living organisms are considered to be <em>non biodegradable</em>.

4. The non biodegradable substance produce a problem in the environment as they persist for a long period of time and also form a major source of pollution for soil and water. Further, they may also cause harm to other living organisms present in the environment.

5. Example of a  non  biodegradable substance is plastic.

You might be interested in
2. use the words Endocytosis and Exocytosis in a sentence
ZanzabumX [31]
A cell would not function as much as it would with the Endocytosis and Exocytosis.
4 0
4 years ago
Read 2 more answers
According to the United Nations, marine debris is possibly one of the most solvable pollution problems in the world. Please sele
Thepotemich [5.8K]
The answer to this question is true.
5 0
3 years ago
Read 2 more answers
The hemoglobin of sickle cell anemia:
Ymorist [56]
The red blood cell is normally circular shaped but for sickle cell anemia the red blood cell is literally sickle shaped so the surface area decreases and less amount of oxygen is stored by the sickle shaped cell thus resulting in low O2 content
6 0
3 years ago
Does marine science include the study of freshwater
Svet_ta [14]

Answer:

No

Explanation:

Freshwater biology is the scientific biological study of freshwater ecosystems and is a branch of limnology.

5 0
3 years ago
Any atom can be considered stable if it has what ?
mr_godi [17]
It's stable of it has an equal amount of <span>protons and electrons</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • Out of the following, which level of organization is the most specific?
    7·1 answer
  • What is the difference between the axial and appendicular skeleton?
    9·2 answers
  • Which is evidence that a chemical reaction has occurred?
    6·1 answer
  • Which of the following are substances intentionally put in foods to enhance appearance, palatability, safety, and/or quality? re
    8·1 answer
  • During discharge patient teaching, the nurse reviews prescriptions with a patient. Which statement is correct about refills for
    12·1 answer
  • Witch steps are important when designing and conducting a scientific experiment
    10·1 answer
  • We just learned about one genetic disease, sickle cell disease. What do you think is the
    15·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • How would you explain why bicarbonate and digestive enzymes respond differently in two of the variables in Figure 30–8?
    14·2 answers
  • Blood contains the rhesus protein.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!