1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
3 years ago
11

Why are mitochondria called the powerhouse of cells

Biology
1 answer:
worty [1.4K]3 years ago
5 0

Mitochondria are known as the powerhouse of cells because they are responsible for the releasing of energy from food. For example: cellular respiration.

You might be interested in
Which energy source would provide the cheapest electricity for a factory
larisa [96]

i would say wind turbines

4 0
4 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What happens at the ribosome?
Misha Larkins [42]
Pretty sure the answer is A
6 0
3 years ago
What is the nearest star to the earth and it can't be the sun
Drupady [299]
Proxima Centauri is the nearest star to Earth.
6 0
4 years ago
Read 2 more answers
What is the basic difference in effector function between helper and cytotoxic T cells?
3241004551 [841]

Answer:

Helper T cells stimulate B-cells to produce antibodies and killer T cells to destroy the non-self cells. Cytotoxic T cells on the other hand are direct attack cells. They can kill the micro organisms by creating pores on the invader's cell.

Explanation:

T lymphocyte mediated immunity of cell mediated immunity do not secrete antibodies but they help stimulate the B cells to produce them. Immature T cells are produced in bone marrow from where they migrate to thymus via blood. In the thymus maturation of T cells occur and then they migrate to lymphoid tissue and get differentiated into three types:

a. Helper T cells: As the name suggests, they help in activating other immune cells, in other terms they are the regulator of virtually all functions of immune system. Protein mediator called lymphokines are produced by these helper T cells in order to regulate the immune functions. Some examples of these lymphokines are: Interleukin-2 interleukin-3, interferon gamma. T helper cells stimulate the B-cells to produce antibodies.

b. Cytotoxic cells or killer T cells: The lymphokine interleukin-2 is responsible for the growth and proliferation of both cytotoxic T cells and suppressor T cells. With the help of receptor proteins on the surface of killer T cells, they bind to the specific antigen. After binding, they secrete a pore forming protein called perforins which create pores on the invaders cell membrane for water to enter into it thereby cell swells and finally lyse.

c. Suppressor T cells: They suppress the function of above two T cells.

5 0
3 years ago
Other questions:
  • 11) Nutrients enter a cell ______ the concentration gradient by the process of _______
    9·1 answer
  • Write the solution in the form and . (use the parametrization derived from the row-reduced echelon form after reindexing the and
    13·1 answer
  • Is rickets an inherited disorder?
    14·1 answer
  • The genes that code for two different traits:
    11·1 answer
  • A geneticist is a scientist who studies genes. Many
    11·1 answer
  • You are studying a disorder that is based on the genetic composition at three loci. Assume that a dominant allele at any locus a
    7·1 answer
  • explain how darwin's observations of finches in the galapagos islands supply evidence for the theory of natural selection?
    13·1 answer
  • Parts of the cells!​
    15·1 answer
  • Carbon dioxide is A a toxic gas produced by landfills. B produced by plants during photosynthesis. C needed by industry to power
    5·1 answer
  • Which of the following is a part of the morphology (structure) of fish?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!