All categories

2 years ago

Ribs are most likely examples of what type of structure

Biology

1 answer:

otez555 [7]2 years ago

3 0

Explanation:

The ribs are a set of twelve bones which form the protective 'cage' of the thorax. They articulate with the vertebral column posteriorly, and terminate anteriorly as cartilage (known as costal cartilage). As part of the bony thorax, the ribs protect the internal thoracic organs.

You might be interested in

The force required to prevent the movement of water across a selectively permeable membrane is __________ pressure

SOVA2 [1]

The force required to prevent the movement of water across a selectively permeable membrane is osmotic pressure. The plasma membrane forms a vesicle around the substances to be transported, and the vesicle around the vesicle is taken into cells.

Osmotic pressure depends on both the pressure gradient and concentration gradient. This is only affected by the temperature and concentration of solute, each affect the movement of water across a membrane.

Higher the concentration is higher temperature increases osmotic pressure, which produced or associate with osmosis and dependent on molar concentration and absolute temperature. Hydro-static pressure forces fluid out of the capillary , osmotic pressure draws fluid back in.

To learn more above the Osmotic pressure here

brainly.com/question/15501096

#SPJ4

5 0

2 years ago

How are learned behaviors related to natural selection?

vlabodo [156]

D. Learned behaviors do not directly affect natural selection because they are not inherited.
This is true because learned behaviors can be taught to the offspring but do not come within them the way instincts do.

7 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Which organism belongs to more than one tropic level

klemol [59]

Any animal that eats meat like snakes and even some herbivores like moose

6 0

3 years ago

A particular protein largely lacks both secondary and tertiary structure. which factor, if any, is mainly responsible for the re

NemiM [27]

Entropy, is mainly responsible for the resting state of this protein.

Hydrogen bonds, disulfide bonds, and dipole-dipole interactions produce the complicated folding styles seen in secondary and tertiary structure. however, if a protein does not have these elements of structure, it'll undertake a kingdom in which its entropy is maximized.

Secondary shape is determined through hydrogen bonding within the amino acid chain backbone. Tertiary structure is the entire protein's form, decided Entropy Interplay and hydrophobic forces. The tertiary shape of a protein is the 3 dimensional shape of the protein. Disulfide bonds, hydrogen bonds, ionic bonds, and hydrophobic interactions all affect the form a protein takes.

The nonpolar amino acids have formed the nonpolar center of the protein, weak van der Waals forces stabilize the protein. furthermore, hydrogen bonds and ionic interactions between the polar, charged amino acids make a contribution to the tertiary structure.

Disclaimer: your question is incomplete, please see below for complete question

A. Entropy

B. Hydrogen bonds between amino acid residues

C. Dipole-dipole interactions

D. None of the above

Learn more about protein here:- brainly.com/question/10058019

#SPJ4

4 0

1 year ago

Ribs are most likely examples of what type of structure ​

Ribs are most likely examples of what type of structure