1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SpyIntel [72]
3 years ago
13

Why is there no such thing as heterozygous recessive

Biology
2 answers:
Igoryamba3 years ago
7 0
Because of their being homozygous recessive their cant be heterozygous recessive.
MA_775_DIABLO [31]3 years ago
3 0
Because there is only homozygous recessive
You might be interested in
Where are the three seismographs used to find the epicenter of this earthquake located?
8090 [49]

Scientists use triangulation to find the epicenter of an earthquake. When seismic data is collected from at least three different locations, it can be used to determine the epicenter by where it intersects. Every earthquake is recorded on numerous seismographs located in different directions. Each seismograph records the times when the first (P waves) and second (S waves) seismic waves arrive. From that information, scientists can determine how fast the waves are traveling. Knowing this helps them calculate the distance from the epicenter to each seismograph.

To determine the direction each wave traveled, scientists draw circles around the seismograph locations. The radius of each circle equals the known distance to the epicenter. Where these three circles intersect is the epicenter.


7 0
3 years ago
Read 2 more answers
After intense activity, your muscles feel sore because of
velikii [3]

Answer:

After intense activity, your muscles feel sore because of _____. a) the accumulation of NAD+ b) the accumulation of lactic acid c) the accumulation of ATP d) the accumulation of carbon dioxide. B. ... ATPc "carbon planet," because carbon is the central element in organic compounds. ... After intense activity, your muscles feel sore because of a. the accumulation of NAD+. b. the accumulation of lactic acid. c. the accumulation of ATP. d. the accumulation of carbon dioxide. b. the accumulation of lactic acid.

Explanation:

srry if this dosent help

5 0
3 years ago
Define "Dynamic Equilibrium"
MakcuM [25]
A state of balance between continuing processes
6 0
3 years ago
Read 2 more answers
Which group of organisms is most closely related to Archeabacteria?
goblinko [34]
The answer is D, Eubacteria.
6 0
3 years ago
Read 2 more answers
8. Agent that kills microorganisms, rather than inhibits it:
Softa [21]

Agent that kills microorganisms, rather than inhibits it: bactericid e

Microbial growth can be controlled and that control usually involves the use of physical or chemical agents. Chemical agents which either kill the microorganisms are called cidal agents while those that prevent their growth are referred to as static agents. of microorganisms. Thus, the term bactericidal refers to killing bacteria, and bacteriostatic refers to inhibiting the growth of bacterial cells.  

4 0
3 years ago
Other questions:
  • A child that is not stimulated with a normal environment is likely to show ____.​
    7·1 answer
  • The ability to change body position and direction quickly and efficiently defines what skill
    15·1 answer
  • Which organelle determines the structural and functional characteristics of the cell by controlling rna and protein synthesis?
    14·1 answer
  • What is the term for a situation in which people have unreliable access to sufficient nourishing food? what is the term for a si
    15·1 answer
  • Menkes disease is a recessive sex-linked disorder that affects copper levels in the body, leading to a copper deficiency. The Pu
    14·2 answers
  • How do the atmospheric conditions near the beginning of the Precambrian time contrast with the atmospheric conditions that are p
    11·1 answer
  • The ancient Egyptians made black eye make-up with which element
    12·1 answer
  • When reading a food label you discover your favorite ice cream has 12 grams of fat per serving and 240 calories. Approximately w
    5·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which approach is most directly concerned with assessing the relative impact of both nature and nurture on our psychological tra
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!