Answer:
Nitrogen thet cannot be used by organisms. C.
Explanation:
Free nitrogen is simply molecular nitrogen (N2). Nitrogen, in its molecular form, consists of two nitrogen atoms bound together with a tripple bond. Because it is very stable, N2 is typically nonreactive, and takes a lot of energy to break them apart. Among these are the amino acids necessary for life to begin and which are the building blocks DNA is made from. Basically, any nitrogen that is in an organic compound is considered “fixed” nitrogen and N2 is considered to be “free” nitrogen
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:Autoimmune hemolytic anemia. Known as AIHA, this condition occurs when the immune system creates antibodies that destroy red blood cells. Because red blood cells carry oxygen to the body's tissues, AIHA can result in a reduced amount of oxygen in the body.
chloroplast and mitochondria interaction are required for the plant to synthesis energy rich organic molecules and later break the down.Chloroplast is responsible in the synthesis of energy rich molecules while mitochondria take the glucose made and convert it to ATP which provide energy.
