1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AnnZ [28]
3 years ago
5

This is a political and economic group that was formed in 1992 to encourage cooperation between the 27 member countries.

Biology
2 answers:
Alla [95]3 years ago
7 0

Answer:

The question define the european union.

EleoNora [17]3 years ago
3 0

Answer: European Union (EU).

Explanation:

The European Union was formed in 1993 with 28 members states which are Bulgaria, Belgium, Bulgaria, Croatia, Republic of Cyprus, Czech Republic, Poland, Denmark, Estonia, Finland, France, Germany, Hungary, Ireland, Italy, Latvia, Lithuania, Slovenia, Luxembourg, Malta, Austria,Netherlands, Portugal, Greece,Romania, Slovakia, Spain ,Sweden and UK. the UK existed from the European Union in 2020 making it 27 member states currently.

You might be interested in
What is the name for all the plants and animals that live together in a habitat?
tia_tia [17]

Answer:

Biotic community

Explanation:

Definition of biotic :living organisms in the ecosystem .Example Frog,fish,and etc.

Definition of Abiotic: Nonliving things in the ecosystem. Examples wind,water,and etc.

4 0
2 years ago
When talking about the formation of fossil fuels, cap rock is a:?
padilas [110]
<span>Dense layer holding in natural gas and petroleum</span>
5 0
3 years ago
The _____________ of a flower develops into the fruit.
sdas [7]
The SEED of a flower develops into the fruit
6 0
3 years ago
A grassland is experiencing a severe drought. The lack of rain is causing the grass to die and the ponds and creeks to dry up.
dusya [7]

The population of fish will decrease.

The population of grazing animals will decrease.

<h3>What is drought?</h3>

A drought is a prolonged period without enough precipitation/water to support people, animals or crops.

With less water, fish and other creatures have fewer places to dwell, swim, and evade predators. In the near run, shrinking streams and lakes necessarily result in fewer fish. Drought conditions can cause water temperatures to rise, affecting cold-water species such as native trout.

The population of grazing animals would decrease as the grass is a food source and without their food source, there would be no source of staying meaning that they would result to finding new food sources through migration likely.

7 0
2 years ago
Which of the following structural adaptations helps an organism obtain food?
lutik1710 [3]

I think its C. The long neck of a giraffe

8 0
3 years ago
Other questions:
  • Ecosystems &amp; Blomes
    9·1 answer
  • Key Concept Check Why is Earth warmer at the equator and<br> colder at the poles?
    13·2 answers
  • What are genes? please help !!!!!!!!!!​
    8·1 answer
  • Study the illustration. The small blue spheres represent water molecules.
    13·2 answers
  • Which is a reactant in the Calvin cycle?
    8·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • You study a bacterium that grows in very low-nutrient aqueous environments. Which type of transport mechanism is required to del
    14·1 answer
  • Which is biotic?
    14·2 answers
  • Why do soils develop different horizons? What separates one horizon from another?
    12·1 answer
  • Which process is best illustrated by the diagram?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!