1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
user100 [1]
3 years ago
8

All subatomic particles have an electrical charge true or false

Biology
1 answer:
Salsk061 [2.6K]3 years ago
8 0
Not all do so your answer is false
You might be interested in
Why might a scientist repeat an experiment if he/she didn't make a mistake in the first one? An experiment should be repeated to
Studentka2010 [4]
Experiments are often replicated or repeated even when no obvious mistake was visible. This is to establish how variable results are. Statistically, multiple runs are used to determine the variance or standard deviation around the average value. The best answer for this is choice C, to double check results.
6 0
3 years ago
Read 2 more answers
Which of the following characteristics of these offspring confirms
padilas [110]

Answer:

The diversity (A)

Explanation:

brainlyest?

:)

5 0
3 years ago
Tom wants to incorporate more organic practices on his farm. He wants to enrich the nitrogen content of his soil through biologi
leonid [27]

legumes, such as beans, peanuts, and alfalfa

6 0
3 years ago
Read 2 more answers
The element oxygen, represented by the symbol O, is classified as
Kipish [7]

Answer:

the element oxygen , represented by the symbol o, is classified as a pure substance

4 0
3 years ago
Which best completes the sentence? If something is made of cells then it A. is a living thing. B. might be a living thing. C. is
IgorLugansk [536]

C us the answer to the answer

7 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE HELPP MEEE I beg youu
    11·1 answer
  • 1. How does inflammation help the immune system to fight<br> pathogens?<br> II
    8·1 answer
  • Doesn't have a science subject but okay.... Whoever helps will get brainiest
    5·1 answer
  • The hydrilla plant was introduced to freshwater habitats, like ponds and streams, in Georgia. Scientists found out that it crowd
    14·2 answers
  • Which word equation summarizes the hydrolysis of a carbohydrate
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Erosion is:
    10·2 answers
  • Is the lytic vacuole in a eukaryotic cell, prokaryotes, or both?
    12·1 answer
  • If blood pressure of a young boy is 120/80 the number 120 is measured when________.
    7·2 answers
  • What's the name of hormone that encourages breast feeding while breastfeeding?​
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!