1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
azamat
2 years ago
15

A high caffeine intake can affect pms symptoms. a. True b. False

Biology
2 answers:
babunello [35]2 years ago
8 0
A. True hope i helped if not im sooooo super sorry
lord [1]2 years ago
4 0
True you may be more tired than before you drunk that coffee ,you might be not that very  hungry,you may be dizzy or have a headache  or not be able to do as much as you did earlier in the day
You might be interested in
PLZ HELP I NEED IT ASAP
RideAnS [48]
It’s D hope that help,
8 0
2 years ago
GRA
Ainat [17]
Yes it is right i did it
5 0
3 years ago
Which of these is an example of precipitation?
Ymorist [56]

Answer:

A. A steady drizzle falls in Pittsburgh.  

Explanation:

Precipitation is any kind of weather in which something is falling from the sky.

A drizzle consists of small water droplets coming from the sky.

B, C, and D are wrong, because nothing is coming from the sky.

8 0
3 years ago
What statement would describe a species that is at carrying capacity
OLga [1]
The species will begin to die off to fall below the carrying capasity
3 0
3 years ago
If thousands of glucose molecules were bonded together with equal numbers of sucrose molecules, the resulting substance could be
zmey [24]
If thousands of glucose molecules were bonded together with equal numbers of sucrose molecules, the resulting substance could be described as a polysaccharide. They are <span>polymeric carbohydrate molecules composed of long chains of monosaccharide units bound together by glycosidic linkages.</span>
4 0
3 years ago
Other questions:
  • Which are observations about the tree on the right? Check all that apply. The tree is a pine tree. The leaves are dark green. Th
    15·1 answer
  • Is this statment true or false ?? the united states population grows when more people are born worldwide each year than die worl
    9·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Changes in the DNA sequence that affect the expression of genetic information are called
    12·1 answer
  • what is the fluid in the space between the meninges that acts as a shock absorber to the brain and spinal cord called ?
    10·1 answer
  • You are a _____ consumer if you feed on secondary consumers.
    13·2 answers
  • What is the difference between Eukaryotic cells and Prokaryotic cells?​
    7·2 answers
  • What source of energy drives the
    10·1 answer
  • What bond must be broken if DNA replication is the to occur
    9·1 answer
  • Which of the following statements is true?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!