1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
13

PLEASE ANSWER BOTH QUESTIONS 3 TIME I POST NO ANSWER :(((((

Biology
2 answers:
Alexandra [31]3 years ago
8 0
D, A

Add extra characters here
Lorico [155]3 years ago
8 0
A makes sense so the answer is <span>A</span>
You might be interested in
The __________ abuts the lumen of the alimentary canal and consists of epithelium
Misha Larkins [42]

Question is incomplete. Complete question is as follows:

The ____ abuts the lumen of the alimentary canal and consists of epithelium, lamina propria, and muscularis mucosae.

Answer:

Mucosa

Explanation:

Mucosa or mucosal membrane forms the lining of many cavities in the body like the alimentary canal and also covers many internal organs. It lines reproductive, digestive and respiratory system. In the gastrointestinal tract the mucosa is made of three layers: epithelium, lamina propria and muscularis mucosae.

The epithelium of mucosa is made of simple columnar epithelium cells. It consists of many types of cells like parietal cells (secrete HCL) and foveolar cells (secrete mucus). Lamina propria is a loose connective tissue present beneath the epithelium. It provides nutrition and support to epithelium. Muscularis mucosae has smooth muscle fibers which helps the glands on the surface to secrete their contents and also increase the contact between contents of lumen and epithelium.

5 0
3 years ago
G=gray fur g-white fur
Liula [17]
GgBb because heterozygous means you have 2 different alleles for both traits
3 0
3 years ago
What is biodiversity an indicator of? A. ecosystem health B. ecosystem growth C. ecosystem decline D. ecosystem location
sattari [20]
Your answer is A, hope it helps!
4 0
2 years ago
I need help with this question I dont know the answer
RUDIKE [14]
The answer is b, closed
3 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
2 years ago
Other questions:
  • Genetic drift can best be defined as
    7·2 answers
  • How to use active transport in a sentence?
    8·1 answer
  • The gradient of a stream depends on its
    9·2 answers
  • A newly developed drug causes users to lose some muscle control and slur their speech. the drug also results in a slowing of cen
    6·1 answer
  • Which way does the sun's gravity act on any body in orbit
    14·2 answers
  • DNA holds the code for what
    8·1 answer
  • Name types of bees and their function in the hive​
    13·2 answers
  • What determines the length of a geologic time period
    5·2 answers
  • Use a Punnett Square of a Bb x Bb cross. B is the factor for brown eyes and bis factor for blue eyes. What color eyes do the par
    15·1 answer
  • The Linnaean suborder prosimians includes Group of answer choices diurnal and nocturnal lemurs. diurnal and nocturnal galagos. o
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!