1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xeze [42]
3 years ago
5

The carrying capacity for a species in an ecosystem is primarily determined by _____.

Biology
1 answer:
aivan3 [116]3 years ago
8 0
The food sources available for a particular species in an ecosystem. Also space where they can live and reproduce, but food is the main factor.
You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
- Monarch butterflies migrate from the U.S. and
kiruha [24]

Answer:4

Explanation:

4 0
3 years ago
How do biologists use genetic engineering to build recombinant DNA?
coldgirl [10]

they combine the DNA of two different organims.

Explanation:

they join together genetic material especially the DNA from different biological species

8 0
2 years ago
Paperclip floating on water - What water property is being shown
schepotkina [342]

Answer:

The water property being shown is surface tension

Explanation:

Due to the surface tension, small objects will "float" on the surface of a fluid, as long as the object cannot break through and separate the top layer of water molecules. When an object is on the surface of the fluid, the surface under tension will behave like an elastic membrane.

6 0
3 years ago
Michelle is observing a sand sample under a microscope when she finds many perforated shelled organisms. Further testing reveals
vazorg [7]
The answer to this question is:

<span>Michelle is observing a sand sample under a microscope when she finds many perforated shelled organisms. Further testing reveals that these shells are made of calcium carbonate. How should she classify these organisms?
</span>"<span>They are foraminiferans, belonging to phylum sarcodina of protozoa."
</span><span>
Hoped This Helped, </span><span> Ariwillow36
Your Welcome :) </span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • WILL GIVE A BRAINLEST
    6·2 answers
  • The endoplasmic reticulum (ER) is a single membrane continuous with the nuclear envelope and a series of interconnected sacs thr
    9·1 answer
  • In order for any animal to grow, repair its body,
    11·2 answers
  • (GIVING BRAINLIEST!!)
    5·1 answer
  • Which is the least complx thing in our body
    6·1 answer
  • A period in history in which humans transitioned from hunting and gathering food to farming of plants and animals.
    7·1 answer
  • How would the DNA in an eye cell and a heart cell compare?
    11·1 answer
  • 1. Bacteria after transduction contains :
    11·1 answer
  • What kinds of substances do you expect to find in a moisturizing cream?
    8·1 answer
  • Describe ways that a human society's culture, agricultural practices, and health practices would be shaped by living in an area
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!