1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Carolina Bays along with cypress and gum ponds are important inland wetlands that provide habitat for a wide range of plants and
mylen [45]
The correct answer is the first option because it says it has partially decomposed plant matter so the fires are keeping it from becoming overgrown.
4 0
3 years ago
Read 2 more answers
Which process transfers heat from inside Earth to its surface? Convection currents in mantle Pulling away of tectonic plates Dra
kondor19780726 [428]
<h3>Answer:</h3>

Convection currents in the mantle

<h3>Explanation:</h3>

Our current laws of Physics recognize that heat is transferred by one of ...

  • conduction
  • convection
  • radiation.

Radiation is a mechanism for transferring heat through space. That mechanism doesn't really apply inside the "solid" Earth. While a certain amount of heat is transferred by conduction, the rock making up the bulk of the Earth is a poor conductor of heat.

The majority of the heat is transferred by the hot rock physically moving from the center of the earth toward the surface in the process called convection.

8 0
3 years ago
Read 2 more answers
Do scientists Know what is causing El Niño?
elena-14-01-66 [18.8K]
Unfortunately, no, all I know about it is that it causes extreme damage.
6 0
3 years ago
How does pH affect cells and cellular processes
wel
The slightest change in pH can destroy the substance or organism. The pH of a cell's interior helps regulate the cell's chemical reactions. For example, the pH of blood is 7.4, if blood falls to 6.8 or lower or 8.2 or higher, it results in death.
6 0
3 years ago
How have finches on the Galápagos Islands adapted to fill specific niches?
lianna [129]

Answer:

A

Explanation:

As the species seperated they formed a differnt beak based on what they ate.

4 0
2 years ago
Other questions:
  • What is ATP? List the three components of an ATP molecule. What is ATP used for?
    13·1 answer
  • A child brought to the emergency department is exhibiting significant signs of hypovolemic shock for which intravenous therapy i
    8·1 answer
  • What is stated in the central dogma
    14·1 answer
  • A dehydrated patient needs to be rehydrated with an IV of Ringer's solution. At the start of their rehydration therapy, right wh
    6·1 answer
  • Identify two factors of climate that determine a biome
    10·1 answer
  • Pls answer biology y8 First answer will get brainlyest
    10·1 answer
  • Which type of energy change causes this leaf to grow? A. Thermal energy is transformed into potential energy. B. Thermal energy
    6·2 answers
  • What molecule contains an organism's genetic material, passed down from parents to their offspring? A. Protein B. Lipid C. DNA D
    13·2 answers
  • GIVING BRAINLIEST!! PLS HELP!!!!
    15·1 answer
  • En cuales sitios del cloroplasto se realizan las fases luminosas y oscura​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!