1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
What is the state of matter with the weakest or no attractive forces?
masya89 [10]
Hello friends

Answer: Gases
3 0
3 years ago
Which term describes resistance to change in motion? A. Acceleration B. Inertia C. Net force D. Velocity
kondaur [170]

Answer:

Inertia

Explanation:

Inertia is the resistance of any physical object to any change in its velocity. This includes changes to the object's speed, or direction of motion.

4 0
3 years ago
Determine whether each example represents continental drift or seafloor spreading
Umnica [9.8K]
Do you have the options?
4 0
3 years ago
Cells can detect changes in their environment and signals from other cells using
ratelena [41]
Receptor proteins, they then send out the signal to perform a task or duty
3 0
3 years ago
What is the first step in the cell reproduction process?
Makovka662 [10]

Answer:

A

Explanation:

DNA must first be replicated before anything else occurs.

8 0
3 years ago
Read 2 more answers
Other questions:
  • What was the main accomplishment of the freedmen's bureau
    9·1 answer
  • About what percent of u.s. adults are either alcohol abusers or alcohol dependent?
    5·1 answer
  • Ryan, an 8-year-old boy, has the habit of swallowing toothpaste. as a result, his teeth have become discolored. it can be said t
    7·1 answer
  • Which of the following statements about resource use is true ?
    14·1 answer
  • Step 3.
    9·1 answer
  • Describe two desert animals and the adaptation that help them survive
    5·1 answer
  • How does interphase prepare cells for mitosis?
    7·2 answers
  • Why do gene mutations occur?
    6·1 answer
  • What property of water allows water to move through materials with pores and cling to the fibers of materials ​
    5·1 answer
  • the importance of glaciers as a force of erosion. Include how glaciers Form, where they form, how they change land, and the land
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!