1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
2 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]2 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Acetic acid, commonly known as vinegar, is sour. Which functional group is present in acetic acid?
weeeeeb [17]
The carboxylic group.
3 0
3 years ago
__________________ are the first organisms to live in an uninhabited area.
Alla [95]
Pioneer species are the first organisms to live in an uninhabited area.
8 0
3 years ago
Read 2 more answers
90 POINT HELP ASAP!!!!!!!!!!!
-BARSIC- [3]

Answer:

Lungs

Explanation:

3 0
3 years ago
Read 2 more answers
Please help asap, I will give brainliest!!!
sdas [7]

Answer:

Biodiversity is a variation of organisms (plants, animals and bacteria) in the world or a specific habitat. Biodiversity helps to keep an ecosystem healthy because there is more variation of food and different organisms can rely on each other for survival. Also it offers a larger more reliable food chain and if one species is suddenly wiped out, it won't impact the ecosystem as much as it would if the biodiversity was smaller.

Explanation:

8 0
2 years ago
If you have a concern about fluoride in your drinking water, how do you get more information?
Charra [1.4K]

Answer:

Contact the Centers for Disease Control and Prevention (CDC).

Explanation:

8 0
3 years ago
Other questions:
  • Which property of nervous tissue is fundamental to its function of coordinating the body's activities?
    8·2 answers
  • Which statement is true about fossils?
    5·1 answer
  • Explain why fertilizer use by farmers can have negative effects on aquatic ecosystems?
    11·1 answer
  • All of the following are directly associated with photosystem I except
    11·1 answer
  • Show the genotypes of the parents and the F1 offspring of a cross between a red and white petunia ​
    8·1 answer
  • Can organs be returned to the body cavity or cremated the appropriate laws and wishes of the family are obeyed ?
    8·1 answer
  • What provides structure for plants
    13·1 answer
  • If a DNA codon changes from TTA to TTC, what amino acid would the matching mRNA sequence code for?
    10·1 answer
  • -Present-day mitochondria and chloroplasts probably evolved as a consequence of early endosymbiosis: the ancestor of the eukaryo
    11·1 answer
  • Help due in 15 mins:(
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!