1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
What is an experiment topic
Zigmanuir [339]
Science experiments can be like “measuring how heart rate is effected by music “
5 0
3 years ago
Why is dna replication said to be semi-conservative
Neko [114]

During DNA Replication, the DNA molecule unzips itself so that there are two free strands of DNA. Both of those strands then create new complementary strands of DNA. Thus every subsequent generation of DNA uses one of the parent cell's strand of DNA as a template, which is why DNA replication is said to be semi-conservative. Hope this helped!

7 0
4 years ago
Which soil type is naturally a fertile soil?<br> Mollisols<br> Aridisols<br> Entisols
enyata [817]
The answer is Mollisols
7 0
3 years ago
Read 2 more answers
When a cell is not dividing, the dna is loosely spread throughout the nucleus in a threadlike form called __________?
Vera_Pavlovna [14]
When a cell is not dividing, the DNA is loosely spread throughout the nucleus in a threadlike form called chromatin.
7 0
3 years ago
Read 2 more answers
Briefly explain how the Industrial Revolution changed agriculture, both on the farm and in cities. Write your response in
taurus [48]

Answer:

he Industrial Revolution made machine-based manufacturing more common, and increased the population and average income. Instead of farming, people came to cities to work. The millions of workers moved from farms and cottage industries to cities; which caused rising population.

Explanation:

Hope this helps!

4 0
3 years ago
Other questions:
  • What kind of inheritance does skin colour represent?
    11·1 answer
  • Darwin believed in the idea that evolution happened slowly over a long period of time called what
    12·1 answer
  • How does tuberculosis(tb) evade the human immune system?
    10·1 answer
  • Select all that apply. Which of the following products are derived from invertebrates? food shell jewelry silk cotton
    15·1 answer
  • Cellular division involves the redistribution of the nuclear material, or DNA, as well as the cytoplasm and organelles. During w
    6·1 answer
  • PLease help! thank you so much!
    6·2 answers
  • Complete these sentences by matching the phrases below.
    7·1 answer
  • Somebody pls help I’m not even sure how to answer but I think it’s between a and d
    10·1 answer
  • The cells of complex multicellular organisms are organized into structures. What is the order of these structures from the most
    14·1 answer
  • If you have 100 apples and you take 30 how many do you have?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!