1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Which part of the neuron below is indicated by the arrow, and what is its function?
Nesterboy [21]
A. The axon carries information through electrical impulses...
3 0
3 years ago
Chris and his friends go swimming in a local river. Afterward, his friends break out with a rash, but he does not. The group soo
Kamila [148]

The statement that best explains why Chris did not get a rash from the water was that Chris's medication has an antagonistic relationship with the toxin in the water. That is option B.

<h3>What is drug-drug interaction?</h3>

Drug-drug interaction is definitely as the relationship that exists between two drugs when administered together or at the same time.

This relationship that exists between the drugs could be:

  • Synergistic relationship or

  • Antagonist relationship.

A synergistic relationship is the type of relationship that occurs between two drugs where by the total effect of the drugs are greater than the sum of the individual effects of each drug.

An antagonistic relationship is the type of relationship that occurs between two drugs where by the both drugs has opposite effects on the body.

Therefore, Chris didn't have the rash because his medication has an antagonistic relationship with the toxin in the water.

Learn more about drugs here:

brainly.com/question/11185154

#SPJ1

3 0
2 years ago
Read 2 more answers
First, describe why an animal is considered a system. Then, explain why an animal is not considered a technological system. ▲
vaieri [72.5K]
A system is a group of organs that work together and provide an organism with an advantage for survival. It is the most complex organization in your body and the final level of the progression from cells to tissues to organs and then systems.
8 0
3 years ago
Please help me out with these practice questions.<br> Thank you!
Oduvanchick [21]

Answer:

1. B.

2. B.

3. A.

Explanation:

1. So, the mother does not but the father does carry the gene for polydactyly. Which means that, the offspring was born Pp and, the dominant trait (P) was exposed.

2. A heterozygous trait is one that has both allele forms (in this case, d and D. If both of the parents are Dd, the offspring will also be Dd, and therefore, he has 1/2 chance of being born deaf.

3. Both you and your spouse will be heterozygous (Ee), therefore, since unattached earlobes are dominant

3.1 When two heterozygous traits are bred, you will get the following combinations: yy, Yy, Yy and YY. Which means that your offspring had a 1/4 chance of having attached earlobes, and that is what happened.

3.2 The third option is incorrect, because when you breed 2 homozygous recessive (ee) traits, all of your offspring will be homozygous recessive (ee), which means that the parents would have to be homozygous recessive, but, they cannot since the dominant trait has applied to them.

4 0
3 years ago
A gene that when mutated leads to organisms with structures in abnormal places is termed select one:
zvonat [6]
Homeotic genes regulate the development of structures. Logically, then, the mutation of this gene must result in improper structure development, such as structures in abnormal places. The answer is C.
3 0
2 years ago
Read 2 more answers
Other questions:
  • What is over utilisation means
    10·1 answer
  • What is a photograph of human chromosomes that may be studied to determine possible genetic disorders known as?
    6·1 answer
  • When elements are more stable in a combined form, which of the following forms?. A. atoms . B. metals . C. nuclei . D. compounds
    14·2 answers
  • 1.
    14·2 answers
  • What is the largest organelle in plants
    5·2 answers
  • Which statement accurately describes the relationship between the brain and addiction?
    15·1 answer
  • Why is the a shell considered to be biotic
    10·2 answers
  • All of earth's water, land, and atmosphere within which life exists is known as
    13·1 answer
  • Prehistoric hunters killed and ate mammoth.Mammoths ate grass.Draw a food chain to show how prehistoric hunters got energy from
    8·1 answer
  • Which step comes between identifying a need and generating ideas in the technological design process?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!