1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Prostaglandins: A. stimulate smooth muscle contraction. B. have four-membered rings and are derived from arachidonic acid. C. ar
nevsk [136]

Answer:

The correct answer is option A, that is, stimulate smooth muscle contraction.

Explanation:

A group of lipids and a hormone that plays an essential role in monitoring the process of the formation of blood clots, stimulation of labor, the flow of blood and inflammation is known as prostaglandins. The hormone prostaglandin takes part in various kinds of body functions like the relaxation and contraction of the smooth muscles at the time of childbirth, monitoring blood pressure, dilation and constriction of blood vessels, and produce inflammation at the site of infection or tissue damage.  

Prostaglandins possess five-membered rings and are obtained from the fatty acid, arachidonic acid. At the time of blood vessel injury, thromboxane, that is, a form of prostaglandin enhances the process of blood clot formation so that the injury site gets heal quickly.  

4 0
4 years ago
Wave is a periodic (1) __________ that moves away from a source which carries (2) __________ with it. Waves can be typified acco
swat32

The correct answers to fill into the blank spaces are;

<h3>What is wave?</h3>

Wave is a periodic <u>disturbance</u> that moves away from a source which carries <u>energy</u> with it. Waves can be typified according to the <u>direction</u> of motion of the vibrating particles with respect to the direction in which the waves travel and according to <u>medium</u> .

<u>Longitudinal</u> waves vibrate perpendicularly to the direction in which the waves travel. This wave exhibits up and down motion. Longitudinal waves vibrate <u>perpendicular</u> or back and forth to the direction in which the waves travel.

<u>Electromagnetic</u> waves are combination of transverse and longitudinal waves. These move in a circular pattern as the waves pass by.

<u>Mechanical</u> waves need solid, liquid and gas medium to propagate or travel. Transverse, mechanical and surface waves are examples of mechanical waves.

Electromagnetic waves do not need <u>medium</u> to propagate. Radio waves, ultraviolet, infrared, and gamma rays are examples of <u>electromagnetic</u> waves. The nature of waves can be described through its terms, quantities and <u>propagation</u>.

The <u>crust</u> and trough refer to the highest point and lowest point of a wave pattern, respectively. The <u>magnitude</u> of a transverse wave is the maximum displacement of a particle of the medium on either side of its normal position when the wave passes. The frequency of periodic waves is the number of waves that pass a particular point for every one second while the <u>Amplitude</u> is the distance between adjacent crests or troughs.

The period is the time required for one complete wave to pass a particular point. The <u>speed</u> of the wave refers to the distance the wave travels per unit time. It is related to the frequency of the wave and wavelength through the following equation: wave speed= frequency x wavelength.

Read more on waves;

brainly.com/question/15531840

5 0
3 years ago
How do i know if i am transgender or not? i feel like i am but do not want to be made fun of
vlabodo [156]
I'm not positive this would be the best place to ask that, I would suggest consulting either a close family member or friend or maybe a therapist. Or if you know someone who is transgender, talk to them, they most likely have the most insight. <span />
6 0
3 years ago
Read 2 more answers
Binding of an eosinophil to an antibody-coated parasitic worm involves binding of the antibody's stem region to a(n) ______.
mestny [16]

Answer:

plasma membrane protein on the eosinophil's surface

Explanation:

Eosinophils sometimes called acidophils are a part of the immune system. The responsible for fighting viral infections and parasites. Eosinophils expresses IgE- binding protein and a protein toxin, cathepsin on the plasma memberane surface along with the SNARE complexes.

Therefore, binding of an eosinophil to an antibody-coated parasitic worm involves binding of the antibody's stem region to a plasma membrane protein on the eosinophil's surface.

4 0
3 years ago
Support irnas claim,using two pieces of evidence from the scientists experiment,figures 1 through 7, and both tables. Explain wh
Ulleksa [173]

Irina's claim is not found here but evidence from an experiment might include the amount of a product (chemical) or the order of nucleotides (biological evidence).

<h3>What is scientific evidence?</h3>

Scientific evidence refers to the observations that can be used to support (or reject) a working hypothesis.

Scientific evidence is variable depending on the field but it is always collected by observational or experimental procedures.

In conclusion, Irina's claim is not found here but evidence from an experiment might include the amount of a product (chemical evidence) or the order of nucleotides (biological evidence).

Learn more about scientific evidence here:

brainly.com/question/507522

#SPJ1

4 0
2 years ago
Other questions:
  • Engulfing-phagocytic cells of innate immunity of vertebrates include _____. i) neutrophils ii) macrophages iii) dendritic cells
    11·1 answer
  • Evidence of the earths past is included in (choose all that apply)
    12·1 answer
  • Which factor is NOT a strong piece of evidence for evolution? A) Fossil records show intermediate forms between modern species.
    13·2 answers
  • What is a isotopes ?
    11·2 answers
  • What is the independent variable in the experiment conducted to determine the effects of the herbicide ZWD10 on corn growth?
    5·1 answer
  • Some single-celled organisms make copies of themselves through mitosis. Which decribes the function of the cell cycle in such si
    5·1 answer
  • Geologists frequently look at the relationships among rock layers. Which statement best describes the information geologists get
    13·1 answer
  • Please help ASAP!!!!
    14·1 answer
  • What is the greatest source of carbon that enters the ocean
    10·1 answer
  • PLS FAST "Can stem cells cure diseases"ESSAY<br> **100 POINTS**
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!