1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Which type of transport does not require energy but uses carrier proteins to help move substances across the cell membrane?
uranmaximum [27]
Passive Transport I belive...
4 0
3 years ago
Read 2 more answers
If two different purebreds are crossed what type of traits will their hybrid offspring have?
Artemon [7]
Answer: Dominant and Recessive traits.

Explanation: I’m not for sure what the question is asking and my answer doesn’t make that much sense to answer the question but I know the offspring will have some form of dominant and recessive traits.
7 0
3 years ago
Which abiotic factor that would affect the ability of a species of tree to survive in a particular habitat
olga nikolaevna [1]

Answer:

Availability of minerals in the soil

8 0
3 years ago
A man pushes a table with a force of
Gala2k [10]

Answer:

Work done (W) = d*f

= 135*35

= 4,725J

I hope you can know this answer..

8 0
3 years ago
Describe the importance of the cell cycle ?
egoroff_w [7]

Explanation:

The way the Cell cycle works helps us keep us alive as long as usually do. An example is when you bite your cheek, you may kill some cells by it but your alive cells will replace them by creating more. Now without the cell cycle here's what would happen, You bite your cheek and your cells die forever causing your mouth to be dryer, weaker and to lack enzymes ( enzymes help brake down your food and ready it to go threw your digestive system ) So imagine every time you get hurt and your cells just keep dying without being reborn that's like as if everyone stopped creating children eventually the human race would end, If the cell cycle does not do its job eventually you will get weak and die. that's why the Cell Cycle is important to any living things well being especially if its Multicellular.

                          Hope this helps! <3

3 0
3 years ago
Other questions:
  • Scientists typically amplify multiple str fragments from an individual in a single pcr. explain how they are able to do that.
    12·1 answer
  • Why is the hypothesis that black cats cause bad luck not science?
    13·1 answer
  • what are two ways that the size of a population can increase ? what are two ways that the size of a population can decrease
    5·2 answers
  • Maalox® manufactures several different types of antacid. Maalox® Extra Strength is a suspension. One teaspoon (5.00 cm3) contain
    5·1 answer
  • What type of polymer can be described as having only one starting point and one ending point
    13·1 answer
  • Which of these is a base?<br><br> ammonia <br><br> HCI<br><br> vinegar<br><br> HNO 3
    5·1 answer
  • Which of the following is true when comparing societal laws to scientific laws?
    13·2 answers
  • A sequence of a DNA template strand is shown.
    6·2 answers
  • Please help me, its due today in the afternoon
    8·2 answers
  • In the citric acid cycle, the acetyl group of each molecule of acetyl-coa is converted into two molecules of ________.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!