1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
A forest ecosystem can support a limited number of bears. This is because?
Gre4nikov [31]

Answer:

A forest ecosystem can support a limited number of bears because bears are the supreme predators of their ecosystem and very few animals can hunt bears so nature by supporting a limited number of bear populations supports a balanced number of population of its prey like insects, fishes, deer.

Another reason for the limited population of bear is that bear occupies the highest trophic level in the ecosystem so according to 10% law of energy transfer, it will get very less energy from its food so it needs to eat more.  

Therefore the population of bears is limited because the environment can not meet the energy requirement of many bears so a forest ecosystem can support a limited number of bears.

8 0
3 years ago
Read 2 more answers
A plate glass window (n = 1.5) has a thickness of 4.5 mm. how long does it take light to pass perpendicularly through the plate?
nirvana33 [79]

The solution to this is to use the n = c / v equation

Where:

c is the speed of light: 3x10^8; and

The idea that v = m/s

So plug in the m/s for v in the n = c v equation and you will get:

1.5 = (3 x 10 ^ 8)/ ((4.5m)/s))

Therefore, the time should be 2.25 x 10 ^ -10 seconds.

4 0
3 years ago
Can you think of other examples of toxics substance, not listed in gizmo?
Kipish [7]

Answer:

3 can you think of other examples of toxic substances not listed in the gizmo from science 101 at Stephen decatur high

4 0
3 years ago
What do you think selectively permeable means?
enot [183]

Answer:

B. The membrane lets certain substances move across it freely, while others must move through a “gate”.

Explanation:

Selective permeability is a property of cellular membranes that only allows certain molecules to enter or exit the cell. This is important for the cell to maintain its internal order irrespective of the changes to the environment. For example, water, ions, glucose and carbon dioxide may need to be imported or exported from the cell depending on its metabolic activity. Similarly, signaling molecules may need to enter the cell and proteins may need to be released into the extracellular matrix. The presence of a selectively permeable membrane allows the cell to exercise control over the quantum, timing and rate of movement of these molecules.

3 0
3 years ago
Read 2 more answers
According to the pressure-flow hypothesis, what mechanism causes the movement of phloem sap from sources to sink tissues? See Se
Vaselesa [24]

Answer:

D) Pressure potential differences between source and sink

Explanation:

high turgor pressure causes the movement of   phloem sap from source to sink, Sap moves through phloem via translocation, the transport of dissolved materials in a plant. Unlike the xylem, which can only carry water upward, phloem carries sap upward and downward, from sugar sources to sugar sinks.

3 0
3 years ago
Other questions:
  • Transpiration in plants requires _____. i) adhesion of water molecules to cellulose ii) cohesion between water molecules iii) ev
    6·1 answer
  • Identify the type of symmetry displayed for each item. then, indicate how you came to your conclusion:
    13·1 answer
  • Which body system is responsible for our movement, energy, and for moving food from one organ to another?
    6·1 answer
  • 5. What is the ratio of carbon:hydrogen:oxygen<br> atoms?
    9·2 answers
  • Identify Causes: What are some factors that might cause changes in the population of grasshoppers?
    6·1 answer
  • What are some ways that plant seeds scatter away from a parent plant?
    9·1 answer
  • Which part of an atom is
    5·1 answer
  • Please help <br> I’ll give brainliest
    12·2 answers
  • What does it mean for an environment to be isotonic?
    5·1 answer
  • What might happen if taxi and police radios used the same frequency band?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!