1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
1 answer:
You might be interested in
Answer: To be in the qualifying weight range wrestler have to lose weight for 8 weeks more.
Explanation:
Current weight of Wrestler = 189 pounds
Maximum Weight required to get qualify = 185 pounds
Weight required to reduced by wrestler= 189 pounds - 185 pounds = 4 pounds
0.5 pounds is reduced in 1 week
1 pound will reduce in = weeks= 2 weeks
4 pounds will reduce in = 2 weeks × 4= 8 weeks
To be in the qualifying weight range wrestler have to lose weight for 8 weeks more.