1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Please answer these 4 questions.
ira [324]

Answer:I just did this exact same thing do we go to the same school lol

Explanation:

6 0
4 years ago
Read 2 more answers
Phytoplankton are __<br><br> A) scavengers<br> B) producers<br> C) consumers<br> D) decomposers
julia-pushkina [17]
B......................
3 0
3 years ago
Gases such as oxygen and carbon dioxide cross the plasma membrane by
djyliett [7]

Answer:miosis

Explanation:

7 0
3 years ago
Read 2 more answers
explain how endosymbiosis is made possible due to the size difference of prokaryotes and eukaryotes.
vladimir1956 [14]
Mitochrondria of the eukaryotic cells.
<span>As many researchers hypothesize that the old single-celled organism or the origin of the complex-celled organisms came from the endosymbiosis of the mitochrondrion organism and the prokaryotic cell. It has been said that mitochondria was an independent organism which then to have been evovled itself after planting itself inside a prokaryotic cell which aided cellular respiration and production of ATP (Adenosine Triphosphate). This then aided the prokaryotic cell to be more sophisticated and caused another change from having without a true nucleus to a eukaryotic cell with a nucleus and embedded DNA. <span>
</span></span>
6 0
3 years ago
How does the skeletal system interact with the nervous system?
Mice21 [21]

Answer:

The skeletal muscles connect to the bones and work with connective tissue at the joints to allow for movement. The muscles connect to the nervous system and allow initiation of movement through nerve signals to and from the brain. The bones and muscles are supported by connective tissue, which plays an integral role in structural support.

7 0
3 years ago
Other questions:
  • The evolutionary concept of ______________ proposes that species that are better able to adapt to the environment are more likel
    8·1 answer
  • How does increasing the total number of tosses from 100 to 200 (or more) affect the deviation?
    15·1 answer
  • A neutral pH level is _____.<br><br> A) 5<br> B) 7<br> C) 8
    12·1 answer
  • When is mitosis complete?
    9·2 answers
  • What are the three main parts that comprise a virus
    7·1 answer
  • Wich solution would most likely cause a plant placeres in it to become finer and more rigid
    9·1 answer
  • Help me out with this​
    6·1 answer
  • How do the kidneys maintain homeostasis in the body?
    5·2 answers
  • Most sex-linked genes are _______.
    5·1 answer
  • Plants that have both imperfect male and imperfect female flowers on a single plant are called (blank).
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!