1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
From the evidence he collected, Darwin concluded that organisms on the Galápagos Islands has,
sashaice [31]
The answer is C.

I'm learning about this:)
Hop this helps
4 0
4 years ago
Read 2 more answers
What is the powerhouse of a cell called?
Vanyuwa [196]

Answer: The powerhouse of a cell is known as the mitochondria.

3 0
3 years ago
Read 2 more answers
A _________ is usually added onto a more pressing and favorable bill so that it has a chance to pass.
Mashcka [7]
<span>d. rider

</span>A <u>RIDER</u> is usually added onto a more pressing and favorable bill so that it has a chance to pass
7 0
4 years ago
The chief limiting factor to the success of most trout species is
koban [17]
The dissolved oxygen content in water
6 0
3 years ago
Helppp Pleasee its for my final exam Ill give the brainliest
galben [10]

Answer:srry just need points

Explanation:hope you get the answer

5 0
3 years ago
Read 2 more answers
Other questions:
  • A. in DNA can result in dysfunctional protein productiona
    5·1 answer
  • The first man sent into space was: Yuri Gagarin Edwin "Buzz" Aldrin Neil Armstrong
    12·1 answer
  • Which type of competition is depicted in this picture
    9·2 answers
  • If G=yellow seeds and g=green seeds, a) predict the genotypic and phenotypic ratios of a cross between a heterozygote and a homo
    14·1 answer
  • Which of the following is the best description of radiation? A. the process by which a liquid is converted to its vapor phase by
    7·1 answer
  • Which scientist became famous for telling the world about environmental harm cause by ddt
    12·1 answer
  • "3. explain the direction of blood flow and the type of blood (oxygenated or deoxygenated) found in each vessel in the pulmonary
    15·1 answer
  • Rainfall in a tropical region is below average for 10 consecutive years. Insect species adapted for dry conditions are much more
    15·1 answer
  • ) An allosteric interaction between a ligand and a protein is one in which: (3 pts) A) binding of a molecule to a binding site a
    6·1 answer
  • Select the correct statement about the heart valves. a. The tricuspid valve divides the left atrium from the left ventricle. b.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!