1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
If a forest experiences a fire, which adaptation would most likely help an organism survive?
kirill115 [55]

Answer:

cellulose

Explanation:

5 0
3 years ago
How many males in the 2nd generation are affected?
Step2247 [10]
I think 3 is the answer
4 0
2 years ago
Choose the system to which this item belongs: adrenal
expeople1 [14]
It would be the endocrine system
7 0
3 years ago
What are three sets of units that can be used for power?<br> Need help plz
KiRa [710]

Answer:

ummm

Explanation:

6+6+9

21

hope that's it but you'll have to tell me the answer cause I don't know it

8 0
3 years ago
The glial cells are specialized in protecting and providing
aleksklad [387]

Answer:

asdada

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Do Prokaryotes have mitochondria?
    8·1 answer
  • The yellow fever virus replicates in lymph nodes and in other immune system cells. how does it arrive in lymph nodes
    12·2 answers
  • When roan cattle are mated, 25% of the offspring are red 50% are roan and 25% w e upon
    10·1 answer
  • I have a 62% rn on my credit recovery and so i have to repet the year but if i get a good score on this quiz maybey ill get a 63
    8·1 answer
  • The image is a food web for a forest ecosystem. Fungi and bacteria decompose the bodies of organisms. Here, the _____ are tertia
    13·2 answers
  • how will the level of carbon in the atmostphere change if humans do nothing to reduce their impact on the carbon cycle?
    8·1 answer
  • The disorder characterized by cells dividing uncontrollably within the body is called
    6·2 answers
  • What is the application of Gene Editing in Primary T Cells?
    7·1 answer
  • True or False: Matter on Earth is never lost. If an animal or plant dies, the matter in the animal or plant will be used over an
    9·1 answer
  • What are the 3 domains of life? Provide an example for each
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!