1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Describe how the presence of lead in body cells could interfere with the
ahrayia [7]

Answer:

Descreva como a presença de chumbo nas células do corpo pode interferir com o capacidade de funcionamento das enzimas. *

Explanation:

espero ter ajudado boa noite

3 0
2 years ago
What is the impact of our energy usage on the earth system ?
bogdanovich [222]
All energy sources have some impact on our environment. Fossil fuels—coal, oil, and natural gas—do substantially more harm than renewable energy sources by most measures, including air and water pollution, damage to public health, wildlife and habitat loss, water use, land use, and global warming emissions.
3 0
3 years ago
Use the drop-down menus to answer some questions about ground tissue.
svetoff [14.1K]

Answer:

Ground tissue is the "fleshy areas"of the plant.

Ground tissue has "many" functions.

5 0
3 years ago
Read 2 more answers
What is the velocity of a wave
r-ruslan [8.4K]

Answer:

go help me on my 3 question please

Wave velocity in common usage refers to speed, although, properly, velocity implies both speed and direction. The velocity of a wave is equal to the product of its wavelength and frequency (number of vibrations per second) and is independent of its intensity.

Explanation:

8 0
3 years ago
Read 2 more answers
How are those 3 characteristics different for rocks?
Nady [450]

Answer:

rocks can be smooth ridged or sharp

Explanation:

there rocks and they can form differently

5 0
3 years ago
Other questions:
  • During reflection, waves are sent
    14·2 answers
  • Which of the following correctly describes the series of events occurring during a parasympathetic nervous system response?
    7·2 answers
  • I need to know 3 things in the human body smaller than a cell
    9·1 answer
  • What major tectonic event occured 40 million years ago?
    9·1 answer
  • Which sentence best describes the function of nucleic acids?
    12·1 answer
  • What do you mean by hypometrophia?​
    6·2 answers
  • 3
    13·1 answer
  • Santos and Lüderitz are the same distance from the equator, and both cities are near the ocean. The air temperature in Lüderitz
    7·1 answer
  • What object is different on every planet in the solar system
    14·2 answers
  • How is it possible to find the
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!