1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Describe the function of each organelle.
Elis [28]

Answer:

Cytoplasm: Fluid between the cell membrane and the nucleus. helps protect organelles

Nucleus: A part of the cell containing hereditary information and is responsible for growth and reproduction; the "command center" of the cell.

Ribosome: A small particle in the cell that can make proteins.

Endoplasmic Reticulum: A cell structure that forms a maze of passageways in which proteins and other materials are carried from one part of the cell to another.

Golgi Apparatus: A cell structure that helps make and package materials to be transported out of the cell or for storage inside the cell.

Lysosome: Cell organelle filled with enzymes needed to break down certain materials in the cell, such as large food particles or old parts of the cell. May be found only in animal cells.

Vacuole: Saclike storage structure in the cell. can store water, nutrients, and even toxic substances.

Mitochondrion: An organelle containing enzymes responsible for producing energy. (Metabolism/respiration)

Chloroplast: An organelle found in the cells of plants and some other organisms that captures the energy from sunlight and converts it into chemical energy (photosynthesis).

Cell membrane: The thin, flexible barrier around a cell; controls what enters and leaves the cell.

Cell wall: The structure outside of the cell membrane that is used to provide support and protection. Present in plants, algae, fungi, and many prokaryotes.

8 0
3 years ago
C6H1206+O2 + some energy—> 6CO2 + 6H2O + ATP + heat is the chemical equation for what
Effectus [21]

Answer:

prob cellular respiration

Explanation

the first part is sugar and oxygen which would result in the second part, carbon dioxide, water, heat, and usable energy. aka reactants to the products

5 0
3 years ago
Integral membrane proteins, such as transport proteins, are permanently attached to cellular membranes. After integral membrane
disa [49]
<span>ER Golgi apparatus, because it packages proteins received from the ER cytoplasm </span>

<span>The Golgi body are the ones that slightly alter, organize and prepare so-called parcels to be delivered for all the organelles in the cell. They receive these packages mainly in the rough endoplasmic reticulum. These packages that set out by Golgi body are macromolecules that used and synthesized by cells in many operations. If ER is absent then it would only mean that Golgi body would have no use other than simply lysosomes but these macromolecules plays a dynamic role in many organelles –nutrients, ATP and cell metabolism. It'll have a ripple effect if ER is absent in the cell.<span> </span></span>

7 0
3 years ago
How are sister chromatids related to one another?
BabaBlast [244]
Two identical copies formed by the replication of a single chromosomes
3 0
3 years ago
PLS HELP!! brainliest + extra points! it's easy but i didn't study tbh:)
NISA [10]

Answer:

Guanine to Cytosine

Explanation:

G always matches C

A always matches T

Hope it helps

Plz mark Brainiest.

4 0
3 years ago
Other questions:
  • Question 3<br> Which of the following statements about environmental changes is true?
    15·1 answer
  • Which natural event produces oxygen, which can then be used by humans and other organisms
    6·1 answer
  • What is ne function of the smooth endoplasmic reticulum?
    13·1 answer
  • Compare the sizes of the different digestive organs. which organ is the largest? how does its size make it well suited for its f
    9·2 answers
  • Use the cell theory to explain why a stuffed animal dog is not alive
    12·1 answer
  • Does fusion take place in the suns core
    15·1 answer
  • I need help with 5-10 please
    5·1 answer
  • What property of a mineral is being observed when looking for what color is left after scratching it on a ceramic plate?
    10·1 answer
  • Which of the following describes an effect of particulate matter on health?
    6·1 answer
  • What information from the client would support the diagnosis of guillain-barré syndrome?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!