1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Early observations of a cultured cell line indicated that the cells did not exhibit either density-dependent inhibition or ancho
pentagon [3]
The cells show characteristics of tumors.  

Tumor cells have the ability to grow and proliferate in absence of adhesion or anchoring. This is particularly helpful during metastasis when a cancer cell travels through the bloodstream to another location.
<span>
A cancerous cell has a number of mutations that regulate cell division. In addition, they exhibit impairment in DNA repair system. Therefore, cancer cell divided fast. Since the DNA repair system is nonfictional, the cells do not pause division to repair the mutation.</span>
6 0
3 years ago
5. Which of the two cell reproduction processes that we learned about in this lesson is the one that is necessary for sexual rep
GaryK [48]
Meiosis is the cell replication of gametes (sex cells).
6 0
3 years ago
The goal of the world resource simulation center is best described as _______. a. solving current problems regarding world resou
natulia [17]

The correct answer is (c) determining how to manage global resources for all humanity

The goal of the world resource simulation center is a very large platform to manage global resources in the form that it serves to all humanity. The team there compiles the inventory of resources, analyses and assess the resources  to solve the current problem as well as anticipated problem. They take help of the emerging technology to solve the problems more precisely. The technology there helps to examine the in-depth problems associated with resources.






8 0
3 years ago
Read 2 more answers
Randy works 50 weeks a year, averaging $500 a week in wages. He is offered a salaried position at $27,500 a year. What will he m
anyanavicka [17]
To calculate his current wage a year you have to multiply the wake of a week with the total amount of weeks when he works.

50*500 = 25000
25000<27500

The correct answer is B. He will get more money. I hope this is the answer that you are looking for and it comes to your help.
8 0
3 years ago
Read 2 more answers
The microorganisms commonly found on the human skin are known as ______?
nekit [7.7K]
C are you dum
Yes this is so easy give me brainiest
8 0
3 years ago
Other questions:
  • The plants that form the basis of rain forests are _____.
    6·2 answers
  • Need household item to represent nucleolus and why
    8·1 answer
  • What is energy?grade 8
    9·1 answer
  • How can we protect the world's biodiversity??
    9·1 answer
  • Why do all Krebs cycle reactions occur twice for each molecule of glucose that undergoes respiration?
    13·2 answers
  • What limits most cells to a very small size?
    5·1 answer
  • Which phrases describe all the outer planets’ motion? Select two options.
    8·2 answers
  • The ocean contains many plants and protists that can make their own food. What do these organisms get by living near the surface
    13·2 answers
  • When water evaporates from plants through leaves, it diffuses through tiny openings called stomatal pores. If the water vapor ne
    6·1 answer
  • Pls answer this guys
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!