1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
What are the two types of reactions enzymes facilitate?
mote1985 [20]
Catalyzed and uncatalyzed
3 0
3 years ago
What is a benefit of using renewable resources?
Harman [31]
<span>Little to No Global Warming, Emissions Improved Public Health, and Environmental Quality.</span>
4 0
4 years ago
A worker sprayed fertilizers, which stimulate the growth of native bacteria, on an oil-soaked area. Which one of the following c
serious [3.7K]
The answer is B. A is impossible and C isn't relevant
7 0
3 years ago
Read 2 more answers
Which of the following describes what might happen with a sudden increase in precipitation in the grassland biome?
yaroslaw [1]

Answer

Nutrient loss and soil erosion

Explanation:

8 0
2 years ago
The largest source of anthropogenic greenhouse gases in the united states is ________, followed by ________.
Dovator [93]
<span>1st blank: Electricity generation
2nd blank: transportation</span>
8 0
3 years ago
Other questions:
  • Each person began as a zygote. Explain why each person has the same genetic makeup as the zygote he or she developed from.
    13·1 answer
  • The ________ is the outermost covering of a fruit.
    6·1 answer
  • How does water temperature affect bullfrog behavior
    6·1 answer
  • 1. Approximately _____ elements occur naturally on earth. 117 25 92 82
    9·2 answers
  • Which of these is an Advantage of multicellular organisms?
    9·2 answers
  • Mention three importance of soil organisms.​
    11·1 answer
  • The number and location of transmembrane segments in an integral membrane protein can be inferred from the amino acid sequence o
    5·1 answer
  • During the process of___ gas loses heat wnd changes into a liquid​
    7·1 answer
  • Which component of RNA<br> replication has a structure similar to that of remdesivir?
    14·1 answer
  • When influenza occurs in unusually large numbers over a specific area it is said to be a/an:___________
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!