1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
2 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]2 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
What causes hotspot volcanism?
Andreas93 [3]
A hot spot is an area in the mantle of the earth where heat increases during the convection phase. This heat makes it easier for rock to melt. The melted lava, known as magma, drives volcanoes into cracks in the crust. There was a mistake. It does happen instead in abnormally hot centers called mantle feathers.
6 0
3 years ago
Can any kind soul help me ASAP ​
Alinara [238K]

Answer:

9- C

cellulose strengthens the cell walls present in a plant

enzymes and antibodies are made of proteins

water is the universal solvent.

10- C, all 3

1- cytoplasm contains about 85% of water, which helps in movement within the cells.

2- urine contains 95% of water, and it dissolve urea and salts in it.

3- plasma contains 90% of water, so we can say that water allows transportation of substances in the blood.

6 0
3 years ago
Do organisms have feelings?
kakasveta [241]

Most human beings do

4 0
3 years ago
Read 2 more answers
Match the part of the cell to its correct function.
s344n2d4d5 [400]
1. k
2. d
3. c
4. j
5. f
6. e
7. l
8. h
9. g
10. b
11. i
12. a                                                                     
I believe these are all right correct me if I am wrong



5 0
3 years ago
Why would a study involving continuous handrail support, oxygen uptake, and heart rate in women during submaximal step treadmill
patriot [66]

The answer is : randomization was not used in sample selection. The major difference between experimental and quasi-experimental designs is lack of randomization in sampling selection.

3 0
2 years ago
Other questions:
  • Which statement best describes both dna and rna?
    10·1 answer
  • What is the backbone of the DNA Chain composed of
    8·2 answers
  • A green pea plant (Gg) reproduces with a yellow pea plant (gg). What is the dominant phenotype?
    5·1 answer
  • keikos teacher was discussing the theory of endosymbiosis. she asked keiko to mark the organelles in the diagram that most close
    6·1 answer
  • A crime scene team has been called in to investigate a crime. The fingerprinting expert dusts the scene with a fine powder and b
    8·2 answers
  • What would you expect ir spectrum of 1,1'- diacetylferrocene to look like?
    6·1 answer
  • What is an element?
    13·1 answer
  • Mr. Ramirez, whose blood type is AB-, has been injured and requires a blood transfusion. Which blood type may be acceptable for
    13·1 answer
  • Describe how you might figure out if something was made out of cells.
    7·1 answer
  • What is pasteurization? what is the advantage of this technique?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!