1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Adh secretion can be stimulated by either blood osmolarity changes or blood pressure changes in the heart or large vessels. TRUE
MrMuchimi
<span>Antidiuretic hormone (ADH) is primarily regulated by the changes in plasma osmolarity. Any alteration in the plasma osmolarity is sensed by the osmoreceptors, which are the neurons present in the hypothalamus. They then, stimulate the secretion of ADH.</span>
5 0
3 years ago
I scientist wants to determine the effect of a new gasoline he feels one of the cars with normal gasoline and the other identica
maxonik [38]
The car with normal gasoline because the effects of that are already known. whereas the car with new gasoline is different and new.
4 0
3 years ago
There are 3 main types of Soil Textures: Clay, Sand, &amp; A Fine B. Loam O C. Coarse 0 D. Silt​
Contact [7]
I think it’s D.silt but don’t get me wrong it just seems right because we are talking about soil
8 0
3 years ago
A species is a group of similar organisms that a. can mate with each other and produce fertile offspring. b. can live together o
andreyandreev [35.5K]
The answer is A. Can mate with each other and produce fertile offspring.
4 0
3 years ago
why doesn't a person's body temperature change significantly if they spend a long time in temperatures below freezing?
lina2011 [118]
Because your body maintains your own thermistat and so your body recycles the heat being produced
5 0
3 years ago
Other questions:
  • Your friend, Raul, has just bought a school organizer and doesn’t understand why there are three different types of calendars in
    8·2 answers
  • Which of the following is an example of a prokaryotic cell?
    14·1 answer
  • Theodor Schwann and Matthias Schleiden were major contributors to the Cell Theory as we know it. In 1839 Schwann published a boo
    12·2 answers
  • Which process releases the greatest amount of ATP
    6·1 answer
  • Identify the type of joint found between the distal end of the tibia and fibula (distal tibiofibular joint). identify the type o
    13·1 answer
  • Drinking too much water during exercise can cause a condition in which concentration of sodium in the blood is lower than normal
    10·2 answers
  • The pond behind Serge's house, with all the living and non-living parts, is an example of a(n)
    9·2 answers
  • Which is associated with low humidity?
    5·2 answers
  • Explain what distinguishes a stroke from a heart attack.
    13·1 answer
  • How does flouride cause kidney deasies
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!