1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksana_A [137]
3 years ago
13

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Biology
1 answer:
Natali5045456 [20]3 years ago
7 0

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

You might be interested in
Describe how carbon skeletons may vary, and explain how this variation contributes to the diversity and complexity of organic mo
Alecsey [184]

Carbon skeletons may vary in length, shape, number and location of double bonds and other elements covalently bonded to available sites.

A carbon atom contains four valence electrons thus, exhibiting a strong tendency to make covalent bonds with other atoms so as to complete its octet. Covalent bonds join carbon atoms together in long chains that create the skeletal framework for organic molecules.

A carbon atom could be linked to as many as four additional carbon atoms in an organic compound. Carbon atoms can also quickly form double bonds (where four electrons are shared among two atoms) and triple bonds (where six electrons are shared).

This variation in carbon skeletons contributes to the diversity and complexity of organic molecules.

To learn more about covalent bonds here

brainly.com/question/10777799

#SPJ4

4 0
2 years ago
He human eye is poorly suited to night vision, suffering impairments in __________.
REY [17]

The human eye is grief in damage of in-depth perception, color recognition, and peripheral vision. Judging speed and distance based on visual evidence is also more difficult in the dark.  In addition, the darkness of night, and even the dimness of dusk and dawn.  

3 0
4 years ago
Read 2 more answers
4. What is the difference between biosphere and ecosystem?
aalyn [17]
The biosphere is everything that makes up life like plants and animals for instance but ecosystem is all the living and nonliving factors that affect the area hope this helps

5 0
3 years ago
Read 2 more answers
Which of the following sequences of processes correctly reflects the central dogma?
Lapatulllka [165]
Transcription, Translation, protein synthesis
4 0
3 years ago
Drag the tiles to the correct boxes to complete the pairs. Match the descriptions to the correct type of fungi. has positive and
aniked [119]

Answer:

Fungi are unicellular or multicellular eukaryotic organisms that are dependent for their energy and food on dead organic material or other organisms. These organisms produce by both sexual and asexual reproduction.

1. club fungi show a bipolar mating system as they have positive and negative mating strands.

2. sac fungi have an erect fruiting body filled with asci.

3. The chytrids have a cell wall of chitin, a flagellum, absorptive structures for nutrition therefore have a lineage.

4. The common molds grow in the form of hyphae and shows all for of nutrition and live in every possible habitate.

8 0
3 years ago
Read 2 more answers
Other questions:
  • True or false?<br> Kinesthetic disorders enhance ones ability to perform voluntary movements..
    11·2 answers
  • What trait most likely evolved in ferns that was not
    14·2 answers
  • Earths inner core is inferred to be solid based on the analysis of
    6·1 answer
  • What is the name of the model of maximum rate of population growth
    11·1 answer
  • Who would most likely study the causes of a present-day epidemic?
    14·1 answer
  • Name two cell structures found in plant cells but not in animal cells, and describe their functions.
    7·2 answers
  • LO 7.3 2. The most usable form of
    11·1 answer
  • One of the laws of motion sates, An Object in motion stays in motion
    6·1 answer
  • Is this statement true or false?
    15·2 answers
  • What would the amino acid this DNA sequence CGA?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!