1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reil [10]
4 years ago
8

Which is a component of a phospholipid?

Biology
1 answer:
Schach [20]4 years ago
3 0
The hydrophobic head is a component of a phospholipid
You might be interested in
Photosynthesis process ​
Andrews [41]

Answer:

(Down Below)

Explanation:

Some plants and bacteria and protistans use the energy from sunlight to produce glucose from carbon dioxide and water. Oxygen is formed too.

5 0
3 years ago
How do microorganisms effect the soil?
kvv77 [185]
Soil microorganisms are very important as almost every chemical transformation taking place in soil involves active contributions from soil microorganisms. In particular, they play an active role in soil fertility as a result of their involvement in the cycle of nutrients like carbon and nitrogen, which are required for plant growth. For example, soil microorganisms are responsible for the decomposition of the organic matter entering the soil (e.g. plant litter) and therefore in the recycling of nutrients in soil. Certain soil microorganisms such as mycorrhizal fungi can also increase the availability of mineral nutrients (e.g. phosphorus) to plants. Other soil microorganisms can increase the amount of nutrients present in the soil. For instance, nitrogen-fixing bacteria can transform nitrogen gas present in the soil atmosphere into soluble nitrogenous compounds that plant roots can utilise for growth. These microorganisms, which improve the fertility status of the soil and contribute to plant growth, have been termed 'biofertilizers' and are receiving increased attention for use as microbial inoculants in agriculture. Similarly, other soil microorganisms have been found to produce compounds (such as vitamins and plant hormones) that can improve plant health and contribute to higher crop yield. These microorganisms (called 'phytostimulators') are currently studied for possible use as microbial inoculants to improve crop yield. 

<span>Micro-organisms isolated from rhizospheres and rhizoplanes of wheat plants, and from root-free soil, produced growth regulating substances with the properties of gibberellins and indolyl-3-acetic acid (IAA). Substances inhibiting extensions of pea plant internodes and lettuce hypocotyls were also produced, especially by bacteria from the root region of seedlings 6 days old. Bacteria producing growth promoting substances were most abundant on roots of older plants. </span>
<span>Seedlings grown aseptically with added gibberellic acid (GA3) and IAA, or grown with a soil inoculum, developed similarly and differed in their morphology from those grown aseptically without additives</span>
5 0
4 years ago
A parent is concerned that the parent's child might suffer from attention deficit hyperactivity disorder (ADHD). The parent brin
slava [35]

Answer:

The child may exhibit the following behavior during the evaluation: When the evaluators assign a task, it is difficult for the child to organize or finish the task, pay attention to details and follow instructions or conversations. because the child is easily distracted.

Other symptoms is that the child may not be sitting for a long time, and the child start running, jumping or climbing around the room.

6 0
3 years ago
Every atom of the blank carbon has 6 protons
Margarita [4]
Hi There! :)

<span>Every atom of the blank carbon has 6 protons

</span><span>element</span>
6 0
4 years ago
Read 2 more answers
A team of scientists is researching the best way to use tides to produce energy.
Lapatulllka [165]

Answer:

oceanography

environmental science

Explanation:

Oceanographers who have an all-around study of the oceans ( including marine science, geology, plate tectonics, ocean current circulation) are well suited to ascertain how best to harness tide energy to produce power. On the other hand, environmental scientists will ensure that during this process, the environmental impact of the project is well understood to protect the marine environment. An environmental scientist will, for example, ensure the protection  of turtle breeding sites on the shores.

Hope this helps

8 0
3 years ago
Other questions:
  • How does cladistics help us understand phylogeny?
    15·1 answer
  • Bone remodeling during which a client's osteoclasts resorb bone
    6·1 answer
  • Formation of the transcription initiation complex begins when general transcription factors bind to a segment of dna called the
    10·1 answer
  • Which of the following must be true to consider something to be alive ? A. it must be able to replicate its DNA b. it must be ab
    11·1 answer
  • 6. How do blood vessels maintain blood flow in the body?
    12·2 answers
  • True or false,"Atoms are composed of electrons and protons
    5·2 answers
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • Protects the cell and controls what enters and leaves the cell
    12·1 answer
  • 24. Which of the following best describes chromosomes? (1 point)
    11·1 answer
  • THINKING
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!