1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergey [27]
2 years ago
10

Dean plays various war games on his computer all the time, even when he has other things (e.g., work and studying) that need to

be done. when dean is unable to perceive his behavior as self-destructive, which symptom of addiction is dean demonstrating
Biology
2 answers:
daser333 [38]2 years ago
8 0
I believe the symptom of addiction that Dean has is denial. a person who is in denial has lost touch with what is real(reality). They usually believe they are right and that they are the ones who know the truth. This this situation Dean is in denial of the fact that playing games has make him lose track of other things in his reality. this has made him to be unable to perceive his behavior is self destructive.
dmitriy555 [2]2 years ago
6 0
There are four symptoms of addiction namely:

Obsession
Negative consequences
Lack of control
Denial

In this patient, he denies that his behavior is self-destructive; even with the concrete evidence that he is being self-destructive (i.e. plays all day even with work to do). There are two descriptions of denial wherein; (1) he denies that what he does cannot be controlled and (2) he denies that what he does leaves a negative impact in his life. This patient falls to the latter description of denial.
You might be interested in
Mendel's work was the foundation for understanding that ____.
Mars2501 [29]

Answer:

the inheritance of certain traits in pea plants follows particular patterns,

Explanation:

3 0
2 years ago
What is more effective natural or artificial photosynthesis?
Shkiper50 [21]
Hello there,
Natural photosynthesis is more effective as it is utilizes energetically efficient primary events of light capture and charge separation.
But Actual photosynthesis is used to help natural photosynthesis

Hope this helps :))

~Top 
3 0
3 years ago
One example of sound energy around the house is
Bad White [126]

Answer:television

Explanation:I guessed

8 0
2 years ago
Read 2 more answers
A polypeptide in a wild type microbe contains the sequence Leu-Pro-Tyr-Ser-Pro. A phenotypic variant of the species has the pept
Katen [24]

Answer:

The mentioned case is an illustration of the missense mutation. A missense mutation is a kind of nonsynonymous substitution, that is, it is a mutation in which a variation in a solitary nucleotide leads to the formation of a codon, which encrypts for a distinct kind of amino acid.  

When a missense mutation takes place within a DNA, a modification in one of the RNA codon sequences results at the time of transcription. This change in codon will ultimately result in the formation of a different amino acid, which gets presented within a protein at the time of translation. Like in the given case, a change in codon resulted in the substitution of the amino acid tyrosine with an amino acid cysteine.  

8 0
3 years ago
The distal end of the humerus has
Vikki [24]

Answer: a. epicondyles

Explanation:

Distally the humerus bone is flattened. It exhibit a prominent bony projection on the medial side it is called as the medial epicondyle of the bone. The lateral epicondyle is present on the lateral side of the distal part of the humerus bone.  

The grasping and powerful muscles of the forearm are attached with the medial epicondyle. It is typically robust and larger as compared to the lateral epicondyle. The lateral epicondyle is attached with the weaker muscles attached posteriorly.

7 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Whats the relationship between magma and lava
    14·2 answers
  • What sugar makes up a part of a DNA nucleotide?
    6·1 answer
  • Give 2 reasons for why meiosis is important for sexual reproduction
    11·2 answers
  • Which of the following chemically weather rocks? Ice , Mosses , Plant roots , Burrowing animals
    12·2 answers
  • Please help on question 5 I’m really confused and I have to hand this in an hour so please help !!!
    13·1 answer
  • When you are frightened by something, what part of the brain directs your body to react by making your heart beat faster and inc
    5·1 answer
  • Deer are natural predators for wolves and coyotes true or false
    9·1 answer
  • Please i need help !!!☹️
    10·1 answer
  • After a severe burn, new skin may grow outward from the hair follicles. Why would new growth originate at the hair follicles
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!