Answer:
a theory should provide the simplest possible (viable) explanation for a phenomenon. and thereby your answer is C
The mass of the object is the sum of the masses which shows the riders:
m = 300.00 g + 20.00 g + 8.00 g
m = 328.00 g
Answer:
The mass of the object is 328.00 grams.
Option (A) Torpor is the correct answer
Organisms that undergo hibernation have the ability to slow down their metabolism so as to lower the core temperature. This process is known as Torpor.
<h3>Why is torpor important for organisms undergoing hibernation?</h3>
Torpor is a state in animals where they lower all their metabolic activities and bodily functions so as to keep the body temperature low.
It is done by the animals to conserve resources in conditions where scarcity of food is there.
Some birds undergo torpor to conserve fat in the body.
Some animals use this technique of torpor to survive competition with other species.
These organisms come back to normal physiology when the conditions become favorable.
Read more about torpor here:
brainly.com/question/10514311
#SPJ4
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: