1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SSSSS [86.1K]
3 years ago
9

In addition to phospholipids, which of the following organic molecules are also a part of cellular membranes?

Biology
1 answer:
guajiro [1.7K]3 years ago
8 0
There are proteins embedded in and attached to the surface of the phospholipid bilayer (cell membrane).
You might be interested in
Can you PLEAZE answer these fast
Juliette [100K]

Answer:

It’s blurry

Explanation:

4 0
3 years ago
Read 2 more answers
Which statement is true about the law of parsimony?
VARVARA [1.3K]

Answer:

a theory should provide the simplest possible (viable) explanation for a phenomenon. and thereby your answer is C

4 0
3 years ago
You are determining the mass of an object using a triple beam balance. When the pointer is lined up with the zero mark, the ride
Nadusha1986 [10]
The mass of the object is the sum of the masses which shows the riders:
m = 300.00 g + 20.00 g + 8.00 g
m = 328.00 g
Answer:
The mass of the object is 328.00 grams.
3 0
2 years ago
Organisms use different types of adaptations to aid in their survival. many different types of animals hibernate throughout the
zalisa [80]

Option (A) Torpor is the correct answer

Organisms that undergo hibernation have the ability to slow down their metabolism so as to lower the core temperature. This process is known as Torpor.

<h3>Why is torpor important for organisms undergoing hibernation?</h3>

Torpor is a state in animals where they lower all their metabolic activities and bodily functions so as to keep the body temperature low.

It is done by the animals to conserve resources in conditions where scarcity of food is there.

Some birds undergo torpor to conserve fat in the body.

Some animals use this technique of torpor to survive competition with other species.

These organisms come back to normal physiology when the conditions become favorable.

Read more about torpor here:

brainly.com/question/10514311

#SPJ4

6 0
2 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Read the sections titled “Retaining Water” and “Acquiring Water.” Explain how desert animals retain and acquire water in such a
    7·2 answers
  • Whats the difference between a neap tide and a spring tide
    13·2 answers
  • Suppose chromosomes in a skin cell are damaged by ultraviolet radiation. if the damaged genes do not effect cell cycle regulatio
    12·2 answers
  • What gene cloning can involve inserting genes into?
    9·1 answer
  • Which event signals the Brain to breathe? Gradpoint
    13·2 answers
  • All of the energy that drives Earth’s rock cycle comes from _____.
    13·2 answers
  • Two competing hypotheses to account for the increase in the number of Hox genes from the last common ancestor of bilaterians to
    11·1 answer
  • Select the answer choice that is
    6·2 answers
  • What would be observed when a growing seedling is placed horizontally​
    7·1 answer
  • Which are not displayed on graph
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!