1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lubov Fominskaja [6]
3 years ago
12

2. (2 pts) According to the cladogram, which organisms develop in an “amniotic egg”?

Biology
1 answer:
IrinaK [193]3 years ago
7 0

Answer:

The answer is primates, rodents/rabbits, crocodiles and birds.

Explanation:

Cladogram

A cladogram is a diagrammatic epresentation of the evolutionary relationships between organisms that emerged from the same ancestor. Basically, it shows how closely one organism is related to another.

A cladogram differs with a phylogenetic tree in the sense that a cladogram only shows evolutionary relationships between one ancestor and all its descendants. On the other hand, a phylogenetic tree explains relationships between many clades (group of related species)

A cladogram also identifies various evolutionary points or milestones of the development of certain characteristics.

According to this cladogram, the amniotic egg evolved before the emergence of the common ancestor of primates, rodents, crocodiles and birds.

You might be interested in
What are gametes? How are gametes different from regular body (somatic) cells?
Wewaii [24]

Answer:

Gamtetes are sex cells, for humans, this manifests as the sperm cell and the egg cell.

Explanation:

Gametes are haploid cells unlike most of our body cells that are diploid cells.

7 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Each row in the auditorium has 18 seats and 246 and teachers are going to watch an assembly in the auditorium how many rows of s
Romashka-Z-Leto [24]

13

Explanation:

We will divide the total number of the teachers (246) in the auditorium with the maximum number of seats per row (18) to determine how many rows are completely filled;

246/ 18  = 13.6667

We are only interested in rows that are completely filled which is the whole number;

= 13

Learn More:

brainly.com/question/13235411

brainly.com/question/2352952

#LearnWithBrainly

3 0
3 years ago
Ethanol is a fuel that can be made from corn. One of the benefits of using a biomass fuel like ethanol is A.It can only be used
liubo4ka [24]
The fact that it's a renewable resource would be the only benefit. All of the others are disadvantages
4 0
3 years ago
Which of these best describes the process by which these organisms<br> obtain energy ?
katrin [286]
I think its anaerobic respiration
3 0
3 years ago
Other questions:
  • What is the difference between an autotroph and a heterotroph?
    14·1 answer
  • In the ocean, communities of plants, algae, and animals are distributed according to the depth of the water and distance from sh
    13·1 answer
  • Nutrients and oxygen diffuse into body cells from ______. A. Arteries B.the aorta C. Capillaries D.veins
    15·2 answers
  • What are some of the effects of human activities on rivers answers?
    10·2 answers
  • A cross is done between two mutant T4 phage (a- b+ c+) and (a+ b-c)(no order implied by these genotypes). The genotypes of the p
    8·1 answer
  • Organic macromolecules called _______ are insoluble in water, are often found in biological membranes and other waterproof cover
    6·1 answer
  • Explain a chromosome deletion and the effect it can have on a human.
    12·2 answers
  • Which is the most comprehensive ecological unit of the biosphere?
    8·1 answer
  • Compound use by cells to store and release energy
    14·1 answer
  • What is an advantage of a debit card compared to a credit card?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!