1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vinvika [58]
3 years ago
6

A standard coffee mug has a cap city of 16 fluid ounces if any needs to fill 48 mugs with coffee how many total quarts of coffee

does she need
Mathematics
1 answer:
Debora [2.8K]3 years ago
5 0

you need 16 oz. for 1 cup

total you need enough for 48 cups

if 1 cup is 16 oz then

16oz x 48 = 768 oz

about 24 quarts of coffee to fill 48 cups

hope this helps

You might be interested in
Evaluate the expression 6/5x when x=20
Sindrei [870]

Answer:

24

Step-by-step explanation:

6 divided by 5 times 20 =24

6/5*20= 24

7 0
2 years ago
Zachary went to the store to buy some walnuts. The price per pound of the walnuts is
Katen [24]
The answer is 12.50 and equation is y=5.25p -3.25
5 0
2 years ago
Solve.<br> X = -7<br> 4x - 4y = 12<br> (x,y)
Fynjy0 [20]

Answer:

(-7, -10)

x=-7\\y=-10

Step-by-step explanation:

4x-4y=12

Substitute x for -7.

4(-7)-4y=12

Multiply 4 by -7.

-28-4y=12

Add 28 on both sides.

-4y=40

Divide -4 on both sides.

y=-10

4 0
3 years ago
The sum of a number and twice its square is 105. Find the number
IRISSAK [1]
N+2^2=105
105-4=101
n=101
hope it helps please mark me as brainliest
 
3 0
3 years ago
A, B and C are points on a circle with a diameter AB
Tamiku [17]

Answer:

36.575

Step-by-step explanation:

you need to find line ab you can do A^{2} +B^{2} =C^{2}  for the triangle and get the line you also need to get the squar root of it as it is still squared then devide by 2 to get the rades then times that by pi and there you go you have the area also sorry for spelling I love math not English

3 0
2 years ago
Other questions:
  • A music industry researcher wants to estimate, with a 90% confidence level, the proportion of young urban people (ages 21 to 35
    15·1 answer
  • Find distance of (-3, 8) and (6,-6)​
    7·2 answers
  • Identify all the three-dimensional figures that result from the rotations of the two-dimensional shapes.
    5·1 answer
  • Triangle L M Q is cut by perpendicular bisector L N. Angle N L Q is 32 degrees and angle L M N is 58 degrees. Is TriangleMNL ≅ T
    6·2 answers
  • Mala has a collection of bangles. She has 20 gold bangles and 10 silver bangles. What is the percentage of bangles of each type?
    12·1 answer
  • There are 32 adults and 20 children at a school play. What is the ratio of children to people at the school play?
    13·2 answers
  • 5.47√0.7(0)<br> Easiest way to explain to solve?
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Is xy= 60 a direct variation or inverse variation
    6·1 answer
  • Helppppppppppppppp asap
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!