1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Trava [24]
3 years ago
11

Select the quantitative observations. Select all that apply.

Biology
2 answers:
drek231 [11]3 years ago
8 0

Answer:

the first and sencond options (1 and 2)

Explanation:

Hunter-Best [27]3 years ago
4 0

Answer:

The CORRECT answer is

Explanation:

The temperature of the water it 23’C.

And

The water has a pH reading of 7.2

You might be interested in
Which of the following are supported by many
Romashka [77]

Answer:

laws.

Explanation:

hypothesis is an educated guess

therous are ideas

and laws are supported by observations. like newton's law.

7 0
3 years ago
Henry was studying two populations of the same species of lizards. One population lived on an island and the other lived on the
Arisa [49]
The answer is B. Genetic drift greatly affects small populations, but large populations can recover.
3 0
3 years ago
I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran
Anarel [89]
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
4 0
3 years ago
What is true for carbohydrates?
Nitella [24]

Answer:

the 3rd one

Explanation:

4 0
3 years ago
Read 2 more answers
Which is an organic molecule?<br><br> C3HNO<br> CeBr3<br> CuSO4<br> CdI2
My name is Ann [436]

Answer:

i think its the first one (I'm not sure tho but i will leave the explianation)

Explanation:

Organic molecules are usually composed of carbon atoms in rings or long chains, to which are attached to other atoms of such elements as hydrogen, oxygen, and nitrogen.

(hope its clear )

3 0
3 years ago
Other questions:
  • Turner's syndrome is a human female disorder characterized by short stature, obesity, and failure to mature sexually. It is caus
    15·2 answers
  • In what way are mitochondria and chloroplasts similar to some prokaryotes cells
    9·1 answer
  • In which two continents are most species of early man found?
    6·1 answer
  • Which sense would you expect a deep ocean organism to rely on the least
    13·1 answer
  • How did fossil fuels form, and how are they obtained and uesd?
    6·1 answer
  • How many legs do spiders have?
    12·2 answers
  • Which of these is an example of an abiotic factor
    6·1 answer
  • On a pedigree chart, males are represented by a circle and females are represented by a square.
    11·2 answers
  • Anton van Leeuwenhoek used a microscope to observe tiny creatures swimming in a drop of pond water.
    11·2 answers
  • HELP PLZZ
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!