1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
3 years ago
12

What is an example of static electricity?

Biology
2 answers:
notsponge [240]3 years ago
7 0
When you rub a ballon in your hair.
TEA [102]3 years ago
6 0
Rubbing a balloon to your hair
You might be interested in
Which of these is an enviormental effect
Oliga [24]
Im pretty sure its C because the olthers dont make sense for deforestation 

6 0
3 years ago
Which type of cell division produces daughter cells that are identical to the original cell?
Vadim26 [7]
<span>Mitosis in animals is the answer.</span>
4 0
3 years ago
Patients with Addison's disease ________.
azamat
Lose salts and water
6 0
3 years ago
While studying the function of a G protein-coupled receptor you develop a modified GTP molecule that has the same binding capabi
laila [671]

<u>Answer:</u>

Effects Include:

Activates secondary messengers such as cAMP which further activates number of hormones like

  • ADH: production of this hormone causes kidneys to retain more water inside body.
  • GHRH: release growth factors and stimulates growth of organism.
  • ACTH: produces fight or flight responses i.e rise in heart beat, rise in Blood pressure etc
  • TSH: Stimulate the synthesis of Thyroid hormone and enhances the metabolism of body. In rare cases causes Goiter without the deficiency of Iodine.
  • LH: Stimulate follicle maturation and formation of ovules in women.
  • Calcitonin: Decreases blood calcium level by deposition calcium in bones. This effect weakens the muscles.
  • Glucagon: Stimulates glycogen breakdown from liver and muscles and many more effects.

<u>Explanation:</u>

Background Knowledge:

GPCR (G Protien coupled receptors) are present inside plasma membrane in huge amount. As name suggest that these receptors are coupled with G proteins during their inactive state present inside of the cell. During their Inactive state these G proteins are bounded with GDP molecule.

Upon receiving signal molecules from outside of cell alters the shape of GPCR. These receptors also triggers change in G Protein, as a result of this GTP get attached with them. This protein further activates reaction cascades inside of the cell.

What happen if GTP cannot be hydrolyzed to GDP + Pi?

If GTP cannot hydrolyzed in to GDP + Pi than, it cannot be able to dissociate from G proteins. Cascade system doesn't stop and produces many effects on body.

Effects Include:

Activates secondary messengers such as cAMP which further activates number of hormones like

  • ADH: production of this hormone causes kidneys to retain more water inside body.
  • GHRH: release growth factors and stimulates growth of organism.
  • ACTH: produces fight or flight responses i.e rise in heart beat, rise in Blood pressure etc
  • TSH: Stimulate the synthesis of Thyroid hormone and enhances the metabolism of body. In rare cases causes Goiter without the deficiency of Iodine.
  • LH: Stimulate follicle maturation and formation of ovules in women.
  • Calcitonin: Decreases blood calcium level by deposition calcium in bones. This effect weakens the muscles.
  • Glucagon: Stimulates glycogen breakdown from liver and muscles and many more effects.
7 0
3 years ago
Glucose-6-phosphate dehydrogenase deficiency (G6PD) is inherited as an X-linked recessive allele in humans. A woman whose father
prohojiy [21]

Answer:

(a) 1/2; (b) no

Explanation:

Glucose-6-phosphate dehydrogenase deficiency (G6PD) is an X-linked recessive disorder and the woman's father was diseased so it means that woman is a carrier of the allele but has normal phenotype. It means that she will have XXᵇ genotype.

In contrast to this, her husband is diseased so his genotype will be XᵇY.

The Punnett square diagram related to the cross is attached.

(a) Proportion of their sons expected to be G6PD is 1/2:

They both may give birth to 4 progeny with genotypes XXᵇ, XᵇXᵇ, XY and XᵇY. It means they both may have 2 sons out of which one with genotype XᵇY will be diseased while the one with genotype XY will be healthy. So the proportion of their sons having G6PD is 1/2 or 50%.

(b) If the husband were G6PD deficient, the answer will not change.

The reason behind this is that this disease is caused by an allele located in X chromosome. But father contributes only Y chromosome to his son not X chromosome. The X chromosome will affect the genotype of his daughter not son that is why answer will not change. It means they will still have 1/2 of their sons diseased.  

7 0
3 years ago
Other questions:
  • If a wave has a wavelength of 1 centimeter, it must be a(n)
    11·2 answers
  • Why are enzymes necessary?
    5·2 answers
  • (please only answer if youre 100% sure &lt;3)What structure would you find in a plant cell that you would not find in an animal
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Que pase durante la telofase
    14·1 answer
  • The Xylem is the vascular tissue that moves water up the plant. Phloem is the vascular tissue that moves food up or down the pla
    11·1 answer
  • A biodegradable substance is
    5·2 answers
  • Which of the following is an autotroph?<br> A) human<br> B) mushroom<br> C) pine tree<br> D) fish
    8·1 answer
  • Is electricity a "green " energy resource ? Explain why or why not.
    11·1 answer
  • Limited resources on the galapagos islands result in?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!