1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zheka24 [161]
4 years ago
6

Which of the following is/are true of pericytes?

Biology
1 answer:
charle [14.2K]4 years ago
6 0

Answer:

D

Explanation:

all of these statement are true.they are multi functional mular cell of microcirculation.

You might be interested in
In a collosion between two billard balls, the total amount of energy before the collsion is equal to the total energy after the
Kobotan [32]
The answer is False
4 0
3 years ago
The unit used to measure period is the ____
erica [24]

Answer:

Answer is B.

Explanation:

<u>Period is duration of time</u>.

Period can be of a second,minute,hour or of Some years.We will give unit according to the duration of time.In the given options second is most obvious because it is used to measure time.

3 0
3 years ago
How many different kinds of gametes (with respect to a particular gene locus) are formed by an individual who is homozygous at t
Gennadij [26K]

There is only one kind of gamete formed by an individual who is homozygous at that particular locus.

<h3>What is the law of segregation? </h3>

Gregor Mendel investigated the trait inheritance in pea plants. He put up a theory in which attributes were determined by pairs of "heritable elements," or genes. Alleles, which are various variants of a gene, exist.

The appearance of the organism is determined by a dominant allele, which conceals a recessive gene. Each gamete produced by an organism has a single gene copy that is chosen at random.

The genotypes (allele combinations) and phenotypes (observable qualities) of progeny from genetic crossings may be predicted using a Punnett square. An organism with a dominant trait can be tested to see if it is homozygous or heterozygous using a test cross.

Therefore, only one kind of gamete will be formed by an organism that is homozygous at that particular locus.

Read more about the law of segregation, here

brainly.com/question/13434823

#SPJ4

5 0
2 years ago
What can change the DNA of a bacteria?
KatRina [158]

Answer: Genetic exchanges among bacteria occur by several mechanisms. In transformation, the recipient bacterium takes up extracellular donor DNA. In transduction, donor DNA packaged in a bacteriophage infects the recipient bacterium. In conjugation, the donor bacterium transfers DNA to the recipient by mating.

3 0
3 years ago
which is not a negative consequence of buring coal? a)causes water pollution and acid rain b) releases large amounts of carbon d
barxatty [35]
From all of the things to choose the one that isnt negative in its way is B. releases carbon
4 0
4 years ago
Read 2 more answers
Other questions:
  • Use the drop-down menus to indicate which endocrine structure is being described in each case.
    13·1 answer
  • This is kind of a school related question because it deals with a science project I have to do. I wanted to ask for some names f
    13·2 answers
  • According to this punnett square, what percentage of the offspring will be female
    6·1 answer
  • One reason the skeletal system is important is because __________. A. without the skeletal system, an individual would not have
    5·2 answers
  • Shorelines change rapidly. Erosion and deposition are two processes with opposite effects that shape shoreline features. Which o
    9·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • I need help with Biology. (50 points)
    7·2 answers
  • Displacement distance wave graphs can be used to determine the​
    15·1 answer
  • NEED HELP ASAP ‼️‼️‼️‼️‼️‼️‼️ What are the chemicals represented by the Y?
    11·1 answer
  • What is earths cosmic address?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!