1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatyana61 [14]
3 years ago
7

Which molecule does atmospheric oxygen initially come from?

Biology
1 answer:
Olin [163]3 years ago
8 0

Answer:

The atmospheric oxygen initially came from the water molecule

Explanation:

Condition on the primitive Earth , about 4 billion year ago were such which favored chemical evolution. . When the temperature of the Earth was less than 100 degree Celsius. Its atmosphere had nitrogen in the form of ammonia, carbon in the form of carbon dioxide and oxygen in the form of water vapour. There was no free oxygen available and so the atmosphere was reducing.

Then spontaneously biomolecules originated which further gave rise to protobionts. These protobionts evolved into several unicellular organisms among which one was cyanobacteria.

Cyanobacteria are considered as the organisms which added the first molecule of free atmospheric oxygen into the atmosphere. They carried out photosynthesis and split the water molecules to release oxygen as the bye product of the process.

You might be interested in
Nearly all plant cells and many bacteria are surrounded by a cell wall. However, the roles these walls play in cell division dif
Makovka662 [10]

Answer: A. protein like tubules

B. Microtubules

C. Microfilaments

Explanation:

Cytokinesis in the bacteria is facilitated by the presence of these conserved tubulin-like proteins. Due to the fact that their walls are flexible, constriction of these walls is possible aiding in cytokinesis. Unlike in plant that have rigid cell wall, a cell plate is involved in the formation of a new cell wall between the daughter cells. Network of microtubules determines the position of the cell plate which is mostly like a disc in the middle of the two daughter cells. Cleavage furrow occurs in animal cells which is caused by the action of the contractile ring: a ring of actin microfilament.

6 0
3 years ago
Match the structural formula to the chemical formula for this substance.
Ivahew [28]
Jensibwkue. Heberibekkowbebdir r
4 0
2 years ago
Read 2 more answers
Identify the benefits to native species of joining similar habitats with corridors
egoroff_w [7]
The benefits were more species and also more resources.<span />
5 0
3 years ago
Which best describes a gamete?
Natalija [7]
The answer would be C. A haploid cell.

Gametes are haploid cells made by meiosis. Male and female gametes fuse together during fertilization and form the diploid zygote.
6 0
2 years ago
Read 2 more answers
State and discuss two types of immunity.<br>​
Illusion [34]

Answer:

How Does the Immune System Work?

Innate immunity: Everyone is born with innate (or natural) immunity, a type of general protection. ...

Adaptive immunity: Adaptive (or active) immunity develops throughout our lives. ...

Passive immunity: Passive immunity is "borrowed" from another source and it lasts for a short time.

7 0
2 years ago
Other questions:
  • Which is the largest organelle within a eukaryotic cell?
    6·1 answer
  • How fast do seismec waves caused by earthquakes travel​
    7·1 answer
  • State of matter with no define shape or no defined volume?
    10·2 answers
  • Where would sugar most likely be present in water?
    10·1 answer
  • Hard time understanding this unit
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Some precipitation that falls to Earth gets soaked up by soil. This water is referred to as water vaporgroundwaterrunoffcondensa
    6·2 answers
  • Mind Buster. Think before giving an answer. <br>c)Foods rich in vitamin c should be eaten raw.​
    5·1 answer
  • If a hydrocarbon chain has a carbon to carbon double bond then it is _______________.
    10·2 answers
  • Write three characteristics of fungi​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!