1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fofino [41]
3 years ago
13

Some inbred strains of the weedy plant Arabidopsis thaliana flower early in the growing season, but other strains flower at late

r times. Four different Arabdiposis plants (1–4) were crossed, and the resulting progeny were tabulated as follows: Mating Progeny 1 × 2 77 late : 81 early 1 × 3 134 late 1 × 4 93 late : 32 early 2 × 3 111 late 2 × 4 65 late : 61 early 3 × 4 126 late a. Explain the genetic basis for the difference in flowering time. How do you know that among this group of plants, the flowering time trait is influenced by the action of a single gene? Which allele is dominant and which recessive? b. Ascribe genotypes to the four plants. c. What kinds of progeny would you expect if you allowed plants 1–4 to self-fertilize, and in what ratios?
Biology
1 answer:
RoseWind [281]3 years ago
3 0

Answer:

a. Let us consider that L is responsible for late and l is responsible for early. From the mentioned data, it can be concluded that allele L or late is dominant over early. By crossing plants 1 and 4 we get the expected ratio of 3: 1, which shows that it follows Mendel's law of dominant.  

b. The genotype of all the four plants are:  

1st plant = Ll

2nd plant = ll

3rd plant = LL

4th plant = Ll

c. If the plant 1 is self-fertilized then the expected progeny will be 3 (late): 1 (early).  

In case if the 2nd plant is self-fertilized, the expected progeny will be only early.  

In case if the 3rd plant is self-fertilized, the expected progeny will be only late.  

In case if the 4th plant is self-fertilized, the expected progeny will be 3 (late): 1 (early).  

You might be interested in
Which of these would generally NOT be considered part of a watershed?
Leno4ka [110]

Which of what? I need more information to decipher that.

4 0
3 years ago
What would be the effect of a high external temperature on amount of urine produced by the kidneys​
kykrilka [37]
Idk i meannn it seemssssssssssss idkkkk
5 0
3 years ago
Read 2 more answers
If the oh sample was 3 how many times more acidic is it then a solution with a ph of 6
grigory [225]

2 because if you were to multiply the bases versus the acidity it would come out to 2

7 0
2 years ago
Why is it important to individualize an integrative treatment plan?
erik [133]

Answer;

To meet the patient's own special needs and circumstances.

Explanation;

-Integrative therapy or treatment focuses on the goals of the patient and family in the context of values, culture, and community. It is a progressive form of psychotherapy that combines different therapeutic tools and approaches to fit the needs of the individual client.

-Integrative therapy is more inclusive of the client than traditional forms of therapy, where the client plays a less active role in treatment.

-Integrative psychotherapists consider the individual characteristics, preferences, needs, physical abilities, spiritual beliefs, and motivation level of their clients and use their professional judgment to decide the best approach to therapy for each client.

3 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Other questions:
  • Give two function of the cell​
    10·2 answers
  • Which term describes an extensive network of tubes, sacs, and vesicles throughout a cell that provides transport as its main fun
    10·2 answers
  • Do we have 23 or 46 chromosomes​
    5·2 answers
  • If mitosis occurs correctly, the division of one cell by mitosis produces _______________ .
    9·2 answers
  • What substance is analogous to a factory manager?
    5·1 answer
  • Ice in a glacier flows somewhat like liquid water. What is the main difference?
    12·2 answers
  • Can you help with 10 thank you
    13·1 answer
  • PBR322, where pBR stands for ................​
    8·1 answer
  • Please help me<br> Which particle, protons, neutrons, or electrons, has the LEAST mass?
    15·2 answers
  • In this lab, you used a dichotomous key to identify organisms. Why would this skill be valuable to you? Check all possible reaso
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!