Which of what? I need more information to decipher that.
2 because if you were to multiply the bases versus the acidity it would come out to 2
Answer;
To meet the patient's own special needs and circumstances.
Explanation;
-Integrative therapy or treatment focuses on the goals of the patient and family in the context of values, culture, and community. It is a progressive form of psychotherapy that combines different therapeutic tools and approaches to fit the needs of the individual client.
-Integrative therapy is more inclusive of the client than traditional forms of therapy, where the client plays a less active role in treatment.
-Integrative psychotherapists consider the individual characteristics, preferences, needs, physical abilities, spiritual beliefs, and motivation level of their clients and use their professional judgment to decide the best approach to therapy for each client.
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand