1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
4

Based on the passage, which three effects did the

Biology
1 answer:
Ilia_Sergeevich [38]3 years ago
4 0

Answer:

The setting affected her decisions

The setting affected her ability to get an education

The setting affected what she wrote in her blog

Explanation:

You might be interested in
Which causes an increase in greenhouse gasses
____ [38]

Answer:

Sun.

Explanation:

The Sun and other gasses work together and increase the greenhouse gasses.

3 0
4 years ago
The estimated number of animals euthanized in shelters each year is ___________ the estimated number of shelter animals adopted
Montano1993 [528]
Approximately 1.5 million
8 0
3 years ago
A snickers® candy bar contains 280 calories, of which the fat content accounts for 120 calories. what is the energy of the fat c
Andrei [34K]

5.0 x 10² KJ

From the question given above,

A snickers® candy bar contains 280 calories. Fat content = 120 calories

1 calorie = 4.184 j

120 calories = 120 x 4,184 = 502.08j = 5.0 x 10² KJ

The energy of the fat content is 5.0 x 10² KJ.






6 0
3 years ago
Read 2 more answers
"Plants can survive on their own, because they make their own food. Animals can’t survive on their own but need plants for survi
ANEK [815]

Answer:A

Explanation:

Yes yes because it is required for photosynthesis to take place. ... he reactants that go into photosynthesis come out of respiration. Plants can survive on their own, because they make their own food. Animals on the other hand, cant survive without any food source

4 0
3 years ago
Which statement best distinguishes plants and animals as they relate to amino acids? Plants can synthesize all twenty amino acid
Allushta [10]

Answer:

Plants can synthesize all twenty amino acids.

Explanation:

8 0
4 years ago
Read 2 more answers
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • What is the role of the mouse? primary producer secondary producer primary consumer secondary consumer
    14·2 answers
  • What would be some of the properties of molecules that could be candidates for biological magnification?
    8·1 answer
  • Motion is a change is what
    8·2 answers
  • Which of these structures forms a complete ring around the airway?
    10·1 answer
  • Condensation reactions are also referred to as dehydration synthesis explain how the name dehydration synthesis is descriptive o
    11·1 answer
  • Radiant energy is a form of...<br> CP
    9·1 answer
  • The eurkaryotic cells glycocalyx is..?
    8·1 answer
  • Which of the following locations would have the slowest rate of weathering?
    13·2 answers
  • what are some good ways to study and stay on task without getting distracted? i need it i have a bio test tomorrow =D
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!