1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
13

Biologists in louisiana have become concerned about cadmium levels in the water near new orleans and the probability that frogs

will die out. They performed an experiment on bullfrog tadpoles to determine how toxic cadmium is to bullfrogs. Suppose a small river with a population of 10,000 frogs becomes polluted with cadmium to a level of 3 mg per gallon per day. About how many bullfrogs would be expected to die?
Biology
2 answers:
natulia [17]3 years ago
7 0

The correct answer is 3,000 bullfrogs.

The survival rate of bullfrogs increases as the amount of Cadmium decreases. This will happen because cadmium is a ubiquitous pollutant in aquatic environments. Cadmiun can alter organismal physiology and ecology affecting their growth and development.


ivann1987 [24]3 years ago
4 0

Answer: 3,000

Explanation: about 3,000

The graph reveals that about 70% of frogs will survive this dose and 30% will die. 10,000 frogs - 3,000 (30%) = 7,000 survivors.

You might be interested in
What is the mean (average) of 101.9, 90.9, and 89.3?
zhenek [66]

Answer:

94.03

Explanation:

add them all together then divide by 3.

7 0
3 years ago
Which of the following structures is considered to be the fundamental building block of the nervous system?
allsm [11]
Neurons because the actually control many of the different receptor cells that make up the cns, like motor neurones and sensory neurones
8 0
3 years ago
Read 2 more answers
How does administration of nitroglycerin help someone that might be suffering from a myocardial infarction?
Zarrin [17]
<span>It lowers your blood pressure drastically to stop blood from backing up during a myocardial infarction.</span>
5 0
3 years ago
What is the primary function of the light dependent reaction of photosynthesis
Svetllana [295]

Answer:

The overall purpose of the light-dependent reactions is to convert light energy into chemical energy.

Hope this helps :)

Explanation:

5 0
3 years ago
DNA contains coded information for _____.
konstantin123 [22]

Answer:

DNA contains coded information for hibernation

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • By what process do streams and rivers move material?
    12·1 answer
  • Kahlia was given antibiotics and told to rest. Bored by spending all day resting, Kahlia decided to learn more about her respira
    12·1 answer
  • Why don't you have mechanical energy<br> when<br> you are<br> laying on the ground?
    10·1 answer
  • The process by which continents break apart.
    11·1 answer
  • The mass of an unidentified rock is 27.5 grams. Students determine the volume of the rock by placing the rock in a cylinder with
    14·1 answer
  • A population of 137 prairie dogs have taken up home in a school football field! The area of a football field is 7140 m2 (1.8 acr
    8·1 answer
  • Hello, I don't mean much, but what are the signs and symptoms of cholera?????
    6·1 answer
  • Why does your upper body want to keep moving when you stop running suddenly?
    5·1 answer
  • Explain why dehydration synthesis make sense as the name of the reaction of creating polymers from monomers.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!