Answer:
The first step in the Scientific Method is to make objective observations. These observations are based on specific events that have already happened and can be verified by others as true or false. Step 2. Form a hypothesis.
Explanation:
Answer:
All of the above answer choices are correct.
Explanation:
Test cross is done to find out the genotype of an individual displaying dominant phenotype as it can be homozygous or heterozygous. To find this the individual is crossed with a recessive phenotype individual. For example: a dominant trait tall height can be homozygous TT or heterozygous Tt. If it is TT all the offspring of test cross with tt will be tall. If it is Tt half of the offspring will be tall and half of the offspring will be short.
Multiple offspring are required to come to the final result because offspring production happens in random order and it might take a few tries before another type of phenotype is produced. For example: If a test cross produces an individual with dominant phenotype we can still not surely say if the test individual is homozygous or heterozygous because both can produce dominant phenotype in test cross. We need more offspring to check if the recessive phenotype is produced or not and accordingly decide the genotype of test individual.
Hence all of the above answer choices are correct.
I got a good call today and I’m just waiting for
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
