1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fynjy0 [20]
3 years ago
6

The Coriolis Effect results in ________. *

Biology
1 answer:
Andreyy893 years ago
3 0

Answer:

A reduction in wind should be your answer. I'm so sorry if its wrong. I tired my best

You might be interested in
Complete the sentence. Water carries minerals called ____ that are critical to many functions in the body.
Zarrin [17]
The best and most correct answer among the choices provided by your question is the third choice or letter C. <span> Water carries minerals called electrolytes that are critical to many functions in the body.

</span>Electrolytes<span> are minerals in your blood and other body fluids that carry an electric charge.
</span><span>
I hope my answer has come to your help. Thank you for posting your question here in Brainly.


</span>
4 0
3 years ago
Read 2 more answers
The reduction of blood volume occurs following severe dehydration and hemorrhage; however, although dehydration results in an in
Ilya [14]

During bleeding, both formed elements (platelets, white blood cells, red blood cells) and plasma are lost from the circulatory system. They are lost proportionally, so initially there is no change in hematocrit.

Hematocrit is the percentage of the blood volume made up of elements (Hct = cell volume/blood volume). During dehydration, only water and electrolytes are lost, and the number of cells remains constant - the same number of cells in a smaller volume leads to an increase in hematocrit. When the body tries to restore blood volume, the first thing to recirculate is water from the ECF and this increases the amount of water without increasing the amount of red blood cells, so the compensatory mechanism causes the hematocrit to fall.

Learn more about  Hematocrit on:

brainly.com/question/13739588

#SPJ4

5 0
1 year ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
What process is necessary to change a sedimentary rock to a metamorphic rock
klasskru [66]

You must use intense Heat and pressure to change a sedimentary rock into a metamorphic

5 0
3 years ago
Read 2 more answers
Nonmetals are located on the right side of the periodic table.<br> TRUE<br> FALSE
pshichka [43]

Answer: true

Explanation: Nonmetals are elements that generally do not conduct electricity. ... They are the elements located on the right side of the periodic table.

8 0
3 years ago
Other questions:
  • Hydrological power harnesses energy through the movement of water in rivers. Which statement represents an added benefit to this
    15·1 answer
  • Short answer for definition of histone ​
    13·2 answers
  • What effect does hydrostatic equilibrium have on a solar system body
    13·1 answer
  • Which of earth layers has the same chemical composition as the mesosphere
    13·1 answer
  • The desire to improve people's lives is a strong motivator for innovation in science , technology , and medicine . A good scient
    5·1 answer
  • Which of the following is true of the light- dependent reacionbut not of the light independent reaction?
    15·2 answers
  • Trace evidence is a type of circumstantial evidence, examples of which include:
    14·1 answer
  • PLSS HELP IMMEDIATELY!!!! ILL MARK U BRAINIEST IF U DONT LEAVE A LINK OR GUESS!!!!!
    14·1 answer
  • Which label belongs in the region marked X?
    7·1 answer
  • a large amount of something in one place? NEED TO KNOW ASAP! A) Solute B) Solvent C)Solution D) Concentration
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!