The punnet square below represents the result of the cross between two tall pea plants.

Biology

1 answer:

erma4kov [3.2K]2 years ago

7 0

Genotype is 1:2:1 (1 Homozygous tall, 2 heterozygous tall, 1 homozygous short)

Phenotype ratio is 3:1

The heterozygous Tt and recessive tt could produce short pea plants if they were crossed.

Explanation:

Genotype is the alleles present for a particular gene. In the Punnett square we can see there will be three tall pea plants and one short pea plant but they can be either homozygous or heterozygous.

While phenotype is the exhibited trait by particular allele that is 3 tall pea plants and one small pea plant.

If Tt and tt are crossed 50 per cent chances of short pea plant is there.

You might be interested in

How does the dust bowl relate to human use and abuse of soil?

vitfil [10]

Answer:

Dust bowl resulted from extreme drying and loosening of the soil that resulted in soil erosion by wind. Thus, it can be related that poor agricultural practices like over plowing , over grazing and leaving the land barren are human activities that must have contributed to the dust bowl.

Explanation:

Dust bowl is referred to a period in early twentieth century when the the American and Canadian prairies faced severe dust storms.
These dust storms resulted from severe drought and failure of practices to prevent soil erosion.
Several people and livestock died as a result of choking.
Over plowing, removal of top soil and small grasses exposed the soil to eroding winds and caused the dust storms.

7 0

2 years ago

⦁ In what stage of an animal’s life cycle do most cells differentiate?

Ber [7]

Answer:

Reproduction

Explanation:

4 0

2 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

"I think the climate is changing," Ben's father said. "Every summer there are more and more hurricanes." Ben's mother did not ag

Step2247 [10]

Based on the given conversation above between Ben and his parents, the testable question for the hurricane research of Ben is option C: "Is the number of hurricanes increasing each year?" This is the testable question since they are arguing about the number of hurricanes in the past summers. Hope this helps.

3 0

2 years ago

A scientist puts mRNA nucleotide chains that contain only Uracil (U) in a test tube. That test tube allows protein synthesis to

RideAnS [48]

An amino acid can be formed by combining 3 nucleobases. In the test, the only nucleobase the mRNA is uracil. That means the possible combination of the nucleobase should be only UUU. Since there is only 1 possible combination, there should be 1 possible amino acid that can be formed.
<span>Phenylalanine should have UUU codon.</span>

6 0

3 years ago