1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Komok [63]
3 years ago
5

Place the rock layers in order from oldest to youngest in the blanks below. Type the letters as they

Biology
1 answer:
yarga [219]3 years ago
3 0

Answer:

C

Explanation:

The principle of superposition states that the oldest sedimentary rock units are at the bottom, and the youngest are at the top. Based on this, layer C is oldest, followed by B and A. So the full sequence of events is as follows: Layer C formed.

You might be interested in
The person credited with being the co-discoverer of evolution by natural selection was
Akimi4 [234]
A mood thing is the answer
4 0
3 years ago
True or False: The following example populations meet the basic requirements of Hardy-Weinberg equilibrium. a. A small, isolated
Setler79 [48]

Answer:

Only option D is TRUE. The rest are FALSE.

Explanation:

In Hardy-Weinberg equilibrium, there is virtually no change in the frequency of alleles and genotype, in a population, meaning there is a genetic equilibrium in that population which shows no real evolutionary change has occurred. According to the , several conditions must be met before such equilibrium can be said to occur in a population, these requirements or conditions are:

1. There must be an unrestricted random mating

2. Mutation that results in the change of gene is absent

3. The population size must be large enough

4. Absence of migration,i.e. no movement of members out of a population or into a population

5. No natural selection

Now let’s take a  at the example of populations given, stating whether they meet the above listed conditions or not

For option A, which is “A small, isolated population of seals living in a stable environment with no genetic mutations” this is False, a small population size of seals is more likely to have its allele frequencies changed by random fluctuations compared to a large population size of seals. This does not satisfy condition number 3 listed above.

Option B, “A large population of fish where females mate with males based on size” is False. It does not satisfy condition number 1 listed above. In this population example, there is restricted random mating.

Option C “A population of birds with no genetic mutations that often mate with members of neighboring bird populations” is False. It does not meet condition 4, because there is exchange of genes with other populations that might have different allele frequencies.

Option D “A large, isolated population of squirrels that lives in a stable environment, has no genetic mutations, and mates randomly” is True. This meets all conditions listed above.

Option E “A large population of spiders that experiences immigration from a second nearby population” is False. This does not meet condition 4.

4 0
3 years ago
What is one of the primary functions of this food in the body?
Ira Lisetskai [31]
To provide energy to build new cells and tissue 
6 0
3 years ago
What are cumulonimbus clouds?
Mazyrski [523]

Explanation:

Cumulonimbus clouds are a type of cumulus cloud associated with thunder storms and heavy precipitation. They are also a variation of nimbus or precipitation bearing clouds. They are formed beneath 20,000 ft. and are relatively close to the ground. ... These clouds often produce lightning in their heart.

7 0
3 years ago
He term autotrophs refer to __________ because of their ability to undergo photosynthesis.
Licemer1 [7]

Answer:

The term autotrophs refer to all plants because of their ability to undergo photosynthesis (the process of food preparation using light as a source)

3 0
3 years ago
Other questions:
  • Why is a strong sense of taste so important for open ocean predators like oceanic whitetip sharks ?
    11·2 answers
  • The bacteria can chemically combine nitrogen with hydrogen to form ammonia (NH3). This combining process is called nitrogen fixa
    12·2 answers
  • Giant fossil ferns have been found in Canada. Which conclusion can be drawn from this discovery?
    8·2 answers
  • This means that the Everglades is most likely
    7·2 answers
  • Which describes a grizzly bear's habitat? All the biotic factors in the ecosystem all the abiotic factors in the ecosystem the r
    13·2 answers
  • 3. Recent years there has been an increase in the number of shark attacks along the Florida beaches. Tahir has been hired by the
    9·2 answers
  • Which of the following is NOT a part of a DNA molecule?
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What change in volume is expected to result in a faster rate of diffusion ?
    10·2 answers
  • A. the tempatures on the islands
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!