Answer: Agriculture is increasingly harming the environment for multiple reasons. One being deforestation. Deforestation reduces ecological services it provides humans produces large amounts of Carbon Dioxide which adds to greenhouse gases -> which add to our current problem with climate change. Additionally, the pesticides and fertilizers agriculture uses can be harmful to the nearby ecosystems as it can end up in surrounding rivers which causes it to cycle back.
Every action has an equal and opposite reaction. I would assume that the energy in the other direction would be an action.. though I'm not entirely sure. I hope it helps.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
HEYA !!!!
Under normal light conditions auxins are spread out in the plant. But when sunlight varies, auxin is broken down on the sunnier side of the stem. The higher concentration of auxin on the shady side causes the plant cells on that side to grow more so it bendstoward the light.
Hope it helps you..
:)
