1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
USPshnik [31]
3 years ago
6

Refer to the illustration of the leaf cross-section. The vein is made up of _________.

Biology
2 answers:
Dmitry [639]3 years ago
5 0

Answer:

Vascular bundles.

Explanation:

Leaf may be defined as the organ of the vascular plant and acts as the principal lateral appendage of the stem parts. Leaf acts as the kitchen house of the cell.

The veins of the leaf helps in the transportation of the materials to and away from the leaf. The veins also support the lamina and radiates from the petiole. The leaf veins are made of the special cells known as the vascular bundle and leaf venation determines the different kind of leaves.

Thus, the answer is vascular bundle.

Harrizon [31]3 years ago
3 0

Answer:

Xylem and phloem

Explanation:

In the question, the figure is not provided but based on the previous knowledge the structure and function of a vein in the plant cell can be explained.

A plant vein is a vascular structure present in the leaves which transports the water and nutrients to the leaves and sugar from the leaves to the different parts of the plant.

Since the vein is a vascular structure therefore it is made up of the xylem which transports the water and the phloem which transports the food material to the leaves and sugar from the leaves to the plant.

Thus, xylem and phloem are correct.

You might be interested in
EUKARYOTIC CELL.
djverab [1.8K]
Do you need the definitions
3 0
3 years ago
What could we have as a testing variable in a chicken bone experiment
lyudmila [28]
It depends, what kind of experiment

6 0
4 years ago
NEED NOW PLEASE <br> Is flower color a<br> characteristic or a trait?
Fed [463]

Answer:

Flower color is a characteristic

Explanation:

hope this helps you find your answer.

5 0
2 years ago
Read 2 more answers
hich of these characteristics would be part of a fungus? A) cells all contain chloroplasts for photosynthesis B) cells contain a
11111nata11111 [884]
B is the correct answer
3 0
3 years ago
Read 2 more answers
Where are chromosomes found in an animal cell? A) inside a gene B) in the cytoplasm Eliminate C) in a strand of DNA D) inside of
iren [92.7K]
They are found in the Cytoplasm
7 0
4 years ago
Read 2 more answers
Other questions:
  • Biologists have discovered ways ________ can reduce the symptoms of diseases. weather diet energy water
    15·2 answers
  • A scientist is studying a new chemical he hopes will prevent insects from eating raspberry bushes. he sprays the chemical on a r
    8·1 answer
  • Will pick more than one :
    6·2 answers
  • List 3 adaptations that permit the frog to live on land successfully
    6·1 answer
  • Carbon dioxide, ethanol, and energy are the products when anaerobic respiration occurs
    5·1 answer
  • What are subdivisions within a species called
    12·1 answer
  • sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
    7·1 answer
  • What sugars are easily used by our bodies?
    13·2 answers
  • How do environmental issues impact food production?
    11·1 answer
  • Does anyone have the answer key to biology semester 1 final exam study guide review 76 questions
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!